Multiple sequence alignment - TraesCS7A01G237400

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS7A01G237400 chr7A 100.000 2360 0 0 1 2360 211272569 211270210 0 4359
1 TraesCS7A01G237400 chr7A 98.349 2362 37 1 1 2360 60120927 60118566 0 4145
2 TraesCS7A01G237400 chr7A 97.798 2362 49 2 1 2360 63429290 63431650 0 4071
3 TraesCS7A01G237400 chr7A 97.544 2362 56 1 1 2360 46394305 46391944 0 4039
4 TraesCS7A01G237400 chr7D 98.518 2362 32 2 1 2360 203518117 203520477 0 4165
5 TraesCS7A01G237400 chr7B 98.391 2362 36 1 1 2360 644470082 644472443 0 4150
6 TraesCS7A01G237400 chr1B 98.010 2362 45 1 1 2360 638698025 638695664 0 4100
7 TraesCS7A01G237400 chr3A 98.010 2362 43 2 1 2360 633113889 633116248 0 4098
8 TraesCS7A01G237400 chr6B 97.925 2361 47 2 1 2360 306993349 306990990 0 4087


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS7A01G237400 chr7A 211270210 211272569 2359 True 4359 4359 100.000 1 2360 1 chr7A.!!$R3 2359
1 TraesCS7A01G237400 chr7A 60118566 60120927 2361 True 4145 4145 98.349 1 2360 1 chr7A.!!$R2 2359
2 TraesCS7A01G237400 chr7A 63429290 63431650 2360 False 4071 4071 97.798 1 2360 1 chr7A.!!$F1 2359
3 TraesCS7A01G237400 chr7A 46391944 46394305 2361 True 4039 4039 97.544 1 2360 1 chr7A.!!$R1 2359
4 TraesCS7A01G237400 chr7D 203518117 203520477 2360 False 4165 4165 98.518 1 2360 1 chr7D.!!$F1 2359
5 TraesCS7A01G237400 chr7B 644470082 644472443 2361 False 4150 4150 98.391 1 2360 1 chr7B.!!$F1 2359
6 TraesCS7A01G237400 chr1B 638695664 638698025 2361 True 4100 4100 98.010 1 2360 1 chr1B.!!$R1 2359
7 TraesCS7A01G237400 chr3A 633113889 633116248 2359 False 4098 4098 98.010 1 2360 1 chr3A.!!$F1 2359
8 TraesCS7A01G237400 chr6B 306990990 306993349 2359 True 4087 4087 97.925 1 2360 1 chr6B.!!$R1 2359

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
188 189 0.177836 TCACCCGGTCTATGCACATG 59.822 55.0 0.0 0.0 0.0 3.21 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2024 2026 0.670162 GGCTGCAGCAAGAAGTTTCA 59.33 50.0 37.63 0.0 44.36 2.69 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
188 189 0.177836 TCACCCGGTCTATGCACATG 59.822 55.000 0.00 0.00 0.00 3.21
460 461 3.632145 GTGCCAGGAAGTTTCTTCTGAAA 59.368 43.478 8.96 0.00 39.59 2.69
521 522 0.740737 CGTTGGGGATTCATTGCTCC 59.259 55.000 0.00 0.00 0.00 4.70
671 672 0.969149 ATGCTCAACTGAGGTCGTGA 59.031 50.000 8.74 0.00 42.29 4.35
686 687 3.374678 GGTCGTGAACAACAACCTTAACA 59.625 43.478 0.00 0.00 0.00 2.41
826 827 2.364056 TTTAGGTAGGGCGGCCGA 60.364 61.111 33.48 15.88 0.00 5.54
1290 1291 1.115930 CCATAGTACCCGCAGCCTCT 61.116 60.000 0.00 0.00 0.00 3.69
1292 1293 0.106167 ATAGTACCCGCAGCCTCTCA 60.106 55.000 0.00 0.00 0.00 3.27
1343 1344 4.439860 AGGGTAAGGGATCTCTTTTCTGT 58.560 43.478 14.35 0.00 0.00 3.41
1403 1405 5.277345 GCACAACCTAACGATACATCCAATC 60.277 44.000 0.00 0.00 0.00 2.67
1999 2001 3.159213 AGGGATGACACTTTCAATGCA 57.841 42.857 0.00 0.00 37.92 3.96
2024 2026 4.516365 AATCCGTTTCGAGTTAGAGTGT 57.484 40.909 0.00 0.00 0.00 3.55
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
81 82 1.802960 GAACCGTACGTGAGACTCTCA 59.197 52.381 15.21 4.5 38.25 3.27
188 189 0.322906 CCAACCTCCTGGAAAGAGCC 60.323 60.000 0.00 0.0 38.96 4.70
248 249 6.574350 ACCTTGATACTAAACCAGATCGAAG 58.426 40.000 0.00 0.0 0.00 3.79
521 522 6.145696 GGCTACATTACTTATAACCGCAGAAG 59.854 42.308 0.00 0.0 0.00 2.85
671 672 4.743493 CTTGTGCTGTTAAGGTTGTTGTT 58.257 39.130 0.00 0.0 0.00 2.83
752 753 0.467290 AAGGCTCGGCTTCAAAACCA 60.467 50.000 0.00 0.0 0.00 3.67
826 827 1.559682 CTACAGGTGCCCATTGTAGGT 59.440 52.381 11.77 0.0 40.20 3.08
832 833 1.308877 AATCCCTACAGGTGCCCATT 58.691 50.000 0.00 0.0 36.75 3.16
1403 1405 1.811558 CGGTAGGCACAGATCATTGGG 60.812 57.143 0.00 0.0 0.00 4.12
1938 1940 6.433093 GCCCTTCCTTTAAGTTTCAGTATTCA 59.567 38.462 0.00 0.0 32.89 2.57
2024 2026 0.670162 GGCTGCAGCAAGAAGTTTCA 59.330 50.000 37.63 0.0 44.36 2.69


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.