Multiple sequence alignment - TraesCS7A01G208900

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS7A01G208900 chr7A 100.000 2504 0 0 1 2504 171431010 171428507 0 4625
1 TraesCS7A01G208900 chr5B 99.202 2505 17 3 1 2504 179239831 179237329 0 4512
2 TraesCS7A01G208900 chr5B 98.762 2505 27 4 1 2504 406858244 406860745 0 4451
3 TraesCS7A01G208900 chr2A 99.122 2505 19 3 1 2504 719466165 719463663 0 4501
4 TraesCS7A01G208900 chr2A 98.724 2507 24 6 1 2504 43392667 43390166 0 4446
5 TraesCS7A01G208900 chr6B 98.922 2505 24 3 1 2504 704838303 704840805 0 4473
6 TraesCS7A01G208900 chr6B 98.803 2506 24 5 1 2504 408674336 408671835 0 4457
7 TraesCS7A01G208900 chr7B 98.803 2506 27 3 1 2504 528912471 528909967 0 4458
8 TraesCS7A01G208900 chr4B 98.602 2504 34 1 1 2504 194231499 194228997 0 4429
9 TraesCS7A01G208900 chr3B 98.602 2503 30 5 1 2501 552490507 552488008 0 4423


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS7A01G208900 chr7A 171428507 171431010 2503 True 4625 4625 100.000 1 2504 1 chr7A.!!$R1 2503
1 TraesCS7A01G208900 chr5B 179237329 179239831 2502 True 4512 4512 99.202 1 2504 1 chr5B.!!$R1 2503
2 TraesCS7A01G208900 chr5B 406858244 406860745 2501 False 4451 4451 98.762 1 2504 1 chr5B.!!$F1 2503
3 TraesCS7A01G208900 chr2A 719463663 719466165 2502 True 4501 4501 99.122 1 2504 1 chr2A.!!$R2 2503
4 TraesCS7A01G208900 chr2A 43390166 43392667 2501 True 4446 4446 98.724 1 2504 1 chr2A.!!$R1 2503
5 TraesCS7A01G208900 chr6B 704838303 704840805 2502 False 4473 4473 98.922 1 2504 1 chr6B.!!$F1 2503
6 TraesCS7A01G208900 chr6B 408671835 408674336 2501 True 4457 4457 98.803 1 2504 1 chr6B.!!$R1 2503
7 TraesCS7A01G208900 chr7B 528909967 528912471 2504 True 4458 4458 98.803 1 2504 1 chr7B.!!$R1 2503
8 TraesCS7A01G208900 chr4B 194228997 194231499 2502 True 4429 4429 98.602 1 2504 1 chr4B.!!$R1 2503
9 TraesCS7A01G208900 chr3B 552488008 552490507 2499 True 4423 4423 98.602 1 2501 1 chr3B.!!$R1 2500

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
621 625 0.905337 AAGCGCCAGAGGAGTAAGGT 60.905 55.0 2.29 0.0 0.0 3.5 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1930 1939 0.673437 CGGGCAATGTGTTGGACTTT 59.327 50.0 0.0 0.0 35.83 2.66 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
148 149 5.747342 TGCCTTATATGACTACCCGTTTTT 58.253 37.500 0.00 0.0 0.00 1.94
489 492 8.970691 AAATCATTTTCGAAACATTCTACCTG 57.029 30.769 10.79 0.0 0.00 4.00
621 625 0.905337 AAGCGCCAGAGGAGTAAGGT 60.905 55.000 2.29 0.0 0.00 3.50
686 690 1.215673 AGAGTCTTCCCGGAGATGCTA 59.784 52.381 0.73 0.0 0.00 3.49
1231 1236 0.545171 ACCATCTCTCACAGCATGGG 59.455 55.000 0.00 0.0 44.77 4.00
1269 1274 1.332889 TGGCAGGAGCTCACGATGAT 61.333 55.000 17.19 0.0 41.70 2.45
1384 1389 7.659799 CGGTCATGGATGTAAATGGAATAACTA 59.340 37.037 0.00 0.0 0.00 2.24
1586 1591 5.796350 ATGTTTTTCTTATCCGGAACTCG 57.204 39.130 9.01 0.0 38.88 4.18
2098 2107 6.292596 GCAGTTATAGCAGCTGATGTCTAAAC 60.293 42.308 20.43 11.2 37.67 2.01
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
148 149 4.828939 AGAAAGAAAACATGACATGCTGGA 59.171 37.500 15.49 0.0 0.00 3.86
621 625 2.288825 CGCTTCCCTCGGCAGATAATTA 60.289 50.000 0.00 0.0 0.00 1.40
686 690 4.111916 CCGCTTTTGTCACTCACATTTTT 58.888 39.130 0.00 0.0 33.90 1.94
1231 1236 4.521639 TGCCATATCTTTGATCATCTTGCC 59.478 41.667 0.00 0.0 0.00 4.52
1269 1274 1.153647 CCATGCGCGTAGGAAGTCA 60.154 57.895 11.22 0.0 0.00 3.41
1384 1389 5.055812 CACAAACTGGCATATGTTGGTTTT 58.944 37.500 4.29 0.0 28.77 2.43
1562 1567 6.934210 CGAGTTCCGGATAAGAAAAACATAG 58.066 40.000 4.15 0.0 33.91 2.23
1586 1591 5.105310 TCCAAAGAGTCTAGATACAGCAACC 60.105 44.000 0.00 0.0 0.00 3.77
1790 1795 5.029807 AGAAGCTAGATTTGCCTAACCTC 57.970 43.478 0.00 0.0 0.00 3.85
1930 1939 0.673437 CGGGCAATGTGTTGGACTTT 59.327 50.000 0.00 0.0 35.83 2.66


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.