Multiple sequence alignment - TraesCS7A01G208800

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS7A01G208800 chr7A 100.000 2924 0 0 1 2924 171418616 171421539 0 5400
1 TraesCS7A01G208800 chr5B 98.539 2943 19 10 1 2924 179226986 179229923 0 5175
2 TraesCS7A01G208800 chr5B 98.234 2945 27 11 1 2924 406870631 406867691 0 5127
3 TraesCS7A01G208800 chr6B 98.437 2943 23 9 1 2924 408661927 408664865 0 5158
4 TraesCS7A01G208800 chr6B 98.404 2944 24 10 1 2924 704850719 704847779 0 5155
5 TraesCS7A01G208800 chr2A 98.369 2943 25 9 1 2924 43380255 43383193 0 5147
6 TraesCS7A01G208800 chr2A 98.335 2943 25 10 1 2924 719453761 719456698 0 5142
7 TraesCS7A01G208800 chr7B 98.335 2943 25 11 1 2924 528879468 528882405 0 5142
8 TraesCS7A01G208800 chr4B 98.166 2945 31 9 1 2924 194219122 194222064 0 5118
9 TraesCS7A01G208800 chr3B 97.219 2949 41 17 1 2924 552478121 552481053 0 4953
10 TraesCS7A01G208800 chr1A 99.142 2331 19 1 594 2924 567477552 567475223 0 4193


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS7A01G208800 chr7A 171418616 171421539 2923 False 5400 5400 100.000 1 2924 1 chr7A.!!$F1 2923
1 TraesCS7A01G208800 chr5B 179226986 179229923 2937 False 5175 5175 98.539 1 2924 1 chr5B.!!$F1 2923
2 TraesCS7A01G208800 chr5B 406867691 406870631 2940 True 5127 5127 98.234 1 2924 1 chr5B.!!$R1 2923
3 TraesCS7A01G208800 chr6B 408661927 408664865 2938 False 5158 5158 98.437 1 2924 1 chr6B.!!$F1 2923
4 TraesCS7A01G208800 chr6B 704847779 704850719 2940 True 5155 5155 98.404 1 2924 1 chr6B.!!$R1 2923
5 TraesCS7A01G208800 chr2A 43380255 43383193 2938 False 5147 5147 98.369 1 2924 1 chr2A.!!$F1 2923
6 TraesCS7A01G208800 chr2A 719453761 719456698 2937 False 5142 5142 98.335 1 2924 1 chr2A.!!$F2 2923
7 TraesCS7A01G208800 chr7B 528879468 528882405 2937 False 5142 5142 98.335 1 2924 1 chr7B.!!$F1 2923
8 TraesCS7A01G208800 chr4B 194219122 194222064 2942 False 5118 5118 98.166 1 2924 1 chr4B.!!$F1 2923
9 TraesCS7A01G208800 chr3B 552478121 552481053 2932 False 4953 4953 97.219 1 2924 1 chr3B.!!$F1 2923
10 TraesCS7A01G208800 chr1A 567475223 567477552 2329 True 4193 4193 99.142 594 2924 1 chr1A.!!$R1 2330

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
476 483 2.800544 CACGACCTCGACAAACAGATTT 59.199 45.455 0.78 0.0 43.02 2.17 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2620 2656 6.18336 CGACCCAGAAAATATTCTCCACTCTA 60.183 42.308 0.0 0.0 44.11 2.43 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
319 325 5.048083 ACAGTTGTTGTTGTTGTGATCTTGT 60.048 36.000 0.00 0.0 36.31 3.16
320 326 6.150307 ACAGTTGTTGTTGTTGTGATCTTGTA 59.850 34.615 0.00 0.0 36.31 2.41
321 327 7.026562 CAGTTGTTGTTGTTGTGATCTTGTAA 58.973 34.615 0.00 0.0 0.00 2.41
476 483 2.800544 CACGACCTCGACAAACAGATTT 59.199 45.455 0.78 0.0 43.02 2.17
501 526 2.870411 GGAAAAGCGACTACACAGTTGT 59.130 45.455 0.00 0.0 38.31 3.32
514 539 3.945285 ACACAGTTGTTCCCAGTACAAAG 59.055 43.478 0.00 0.0 37.26 2.77
738 763 5.221904 ACCATGCATATGTATGAGTTGCCTA 60.222 40.000 28.94 0.0 39.98 3.93
2668 2704 1.396653 GTGCAGCAAGGAAGGCATAT 58.603 50.000 0.00 0.0 38.68 1.78
2861 2897 2.742348 TCCTTGAAGCAATGCATGGAT 58.258 42.857 8.35 0.0 34.55 3.41
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
319 325 2.354203 GCATTGTTCCCCGCCATTTTTA 60.354 45.455 0.00 0.00 0.00 1.52
320 326 1.610363 GCATTGTTCCCCGCCATTTTT 60.610 47.619 0.00 0.00 0.00 1.94
321 327 0.036483 GCATTGTTCCCCGCCATTTT 60.036 50.000 0.00 0.00 0.00 1.82
476 483 3.181469 ACTGTGTAGTCGCTTTTCCAAGA 60.181 43.478 0.00 0.00 28.79 3.02
501 526 8.810990 TTTTCTCTTAAACTTTGTACTGGGAA 57.189 30.769 0.00 0.00 0.00 3.97
645 670 6.603201 AGACATTTTCTTGGAGTGTTTTCAGA 59.397 34.615 0.00 0.00 0.00 3.27
2620 2656 6.183360 CGACCCAGAAAATATTCTCCACTCTA 60.183 42.308 0.00 0.00 44.11 2.43
2668 2704 4.271661 TGCAATCATGATAAGCTTCCACA 58.728 39.130 24.81 2.15 0.00 4.17
2861 2897 1.832883 ATGATGTTGGTTGGCGCTAA 58.167 45.000 7.64 4.03 0.00 3.09


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.