Multiple sequence alignment - TraesCS7A01G198700

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS7A01G198700 chr7A 100.000 2531 0 0 1 2531 160993500 160990970 0.000000e+00 4674.0
1 TraesCS7A01G198700 chr7A 98.284 2098 35 1 435 2531 116057310 116055213 0.000000e+00 3674.0
2 TraesCS7A01G198700 chr7A 91.229 1847 147 12 693 2531 54862213 54860374 0.000000e+00 2499.0
3 TraesCS7A01G198700 chr7A 97.442 430 10 1 1 430 116058029 116057601 0.000000e+00 732.0
4 TraesCS7A01G198700 chr5A 98.429 2101 29 4 432 2531 638638740 638640837 0.000000e+00 3694.0
5 TraesCS7A01G198700 chr5A 98.140 430 8 0 1 430 638638023 638638452 0.000000e+00 750.0
6 TraesCS7A01G198700 chr2A 94.154 2104 96 13 435 2531 533180593 533178510 0.000000e+00 3179.0
7 TraesCS7A01G198700 chr2A 96.279 430 16 0 1 430 533181312 533180883 0.000000e+00 706.0
8 TraesCS7A01G198700 chr2A 92.222 90 7 0 443 532 489243967 489244056 7.350000e-26 128.0
9 TraesCS7A01G198700 chr5B 91.410 1851 140 14 693 2531 523901449 523899606 0.000000e+00 2519.0
10 TraesCS7A01G198700 chr5B 85.965 114 16 0 443 556 703769683 703769570 3.420000e-24 122.0
11 TraesCS7A01G198700 chr5B 94.340 53 3 0 580 632 703769192 703769140 5.800000e-12 82.4
12 TraesCS7A01G198700 chr6A 91.220 1845 149 10 693 2531 577050676 577048839 0.000000e+00 2497.0
13 TraesCS7A01G198700 chr6A 90.159 1382 125 11 693 2071 46445426 46446799 0.000000e+00 1788.0
14 TraesCS7A01G198700 chr6A 86.842 114 15 0 443 556 20722471 20722584 7.350000e-26 128.0
15 TraesCS7A01G198700 chr6A 100.000 29 0 0 633 661 58851784 58851756 1.000000e-03 54.7
16 TraesCS7A01G198700 chr1B 95.116 1208 38 7 781 1987 18657455 18656268 0.000000e+00 1884.0
17 TraesCS7A01G198700 chr1B 91.616 489 19 9 435 920 18657924 18657455 0.000000e+00 656.0
18 TraesCS7A01G198700 chr1B 97.447 235 6 0 1 235 18659980 18659746 3.920000e-108 401.0
19 TraesCS7A01G198700 chr1B 95.455 198 8 1 233 430 18658411 18658215 5.260000e-82 315.0
20 TraesCS7A01G198700 chrUn 90.775 748 59 6 1794 2531 11852087 11852834 0.000000e+00 990.0
21 TraesCS7A01G198700 chrUn 90.642 748 60 6 1794 2531 318613204 318613951 0.000000e+00 985.0
22 TraesCS7A01G198700 chrUn 90.642 748 60 6 1794 2531 385585134 385585881 0.000000e+00 985.0
23 TraesCS7A01G198700 chrUn 91.314 449 38 1 1351 1799 11851485 11851932 1.660000e-171 612.0
24 TraesCS7A01G198700 chrUn 92.875 393 25 2 693 1085 11851072 11851461 3.650000e-158 568.0
25 TraesCS7A01G198700 chrUn 92.875 393 25 2 693 1085 318612189 318612578 3.650000e-158 568.0
26 TraesCS7A01G198700 chrUn 100.000 28 0 0 635 662 276684020 276683993 5.000000e-03 52.8
27 TraesCS7A01G198700 chrUn 100.000 28 0 0 635 662 276739796 276739823 5.000000e-03 52.8
28 TraesCS7A01G198700 chr3B 84.431 167 20 4 268 434 108285463 108285623 2.610000e-35 159.0
29 TraesCS7A01G198700 chr2B 84.663 163 19 4 268 430 2710352 2710508 9.370000e-35 158.0
30 TraesCS7A01G198700 chr2B 100.000 31 0 0 632 662 614039547 614039577 9.780000e-05 58.4
31 TraesCS7A01G198700 chr3A 84.076 157 14 1 215 360 560754513 560754669 9.440000e-30 141.0
32 TraesCS7A01G198700 chr3A 97.368 38 1 0 580 617 560755323 560755360 5.840000e-07 65.8
33 TraesCS7A01G198700 chr3A 96.875 32 1 0 631 662 46637909 46637940 1.000000e-03 54.7
34 TraesCS7A01G198700 chr4B 91.026 78 7 0 443 520 328587990 328588067 3.440000e-19 106.0
35 TraesCS7A01G198700 chr4B 94.340 53 3 0 580 632 309437899 309437847 5.800000e-12 82.4
36 TraesCS7A01G198700 chr4B 93.750 48 3 0 585 632 328588484 328588531 3.490000e-09 73.1
37 TraesCS7A01G198700 chr1A 92.453 53 4 0 580 632 517449423 517449371 2.700000e-10 76.8


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS7A01G198700 chr7A 160990970 160993500 2530 True 4674.000000 4674 100.000000 1 2531 1 chr7A.!!$R2 2530
1 TraesCS7A01G198700 chr7A 54860374 54862213 1839 True 2499.000000 2499 91.229000 693 2531 1 chr7A.!!$R1 1838
2 TraesCS7A01G198700 chr7A 116055213 116058029 2816 True 2203.000000 3674 97.863000 1 2531 2 chr7A.!!$R3 2530
3 TraesCS7A01G198700 chr5A 638638023 638640837 2814 False 2222.000000 3694 98.284500 1 2531 2 chr5A.!!$F1 2530
4 TraesCS7A01G198700 chr2A 533178510 533181312 2802 True 1942.500000 3179 95.216500 1 2531 2 chr2A.!!$R1 2530
5 TraesCS7A01G198700 chr5B 523899606 523901449 1843 True 2519.000000 2519 91.410000 693 2531 1 chr5B.!!$R1 1838
6 TraesCS7A01G198700 chr6A 577048839 577050676 1837 True 2497.000000 2497 91.220000 693 2531 1 chr6A.!!$R2 1838
7 TraesCS7A01G198700 chr6A 46445426 46446799 1373 False 1788.000000 1788 90.159000 693 2071 1 chr6A.!!$F2 1378
8 TraesCS7A01G198700 chr1B 18656268 18659980 3712 True 814.000000 1884 94.908500 1 1987 4 chr1B.!!$R1 1986
9 TraesCS7A01G198700 chrUn 385585134 385585881 747 False 985.000000 985 90.642000 1794 2531 1 chrUn.!!$F2 737
10 TraesCS7A01G198700 chrUn 318612189 318613951 1762 False 776.500000 985 91.758500 693 2531 2 chrUn.!!$F4 1838
11 TraesCS7A01G198700 chrUn 11851072 11852834 1762 False 723.333333 990 91.654667 693 2531 3 chrUn.!!$F3 1838

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
446 2071 1.626321 ACACATGGGGATCAACGTGTA 59.374 47.619 11.84 0.0 41.36 2.90 F
757 2385 2.109128 CTCCCCCTCTCTCTATGTGCTA 59.891 54.545 0.00 0.0 0.00 3.49 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1362 3134 0.602905 GTCGTAGGCAAGCCACTTGT 60.603 55.000 14.40 0.0 42.77 3.16 R
1872 3808 2.054021 TCCACCAAGATCCTTGTGTCA 58.946 47.619 6.04 0.0 0.00 3.58 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
27 28 4.740695 AGTTTCGTCAAGTTCTCTTTCGAG 59.259 41.667 0.00 0.00 38.04 4.04
41 42 6.176896 TCTCTTTCGAGAGAGAAGAATCTCA 58.823 40.000 28.10 7.09 46.80 3.27
80 81 4.037208 AGCGACTAGGTAAAATAGCGCTTA 59.963 41.667 18.68 0.00 45.18 3.09
413 1751 4.973168 AGCATTCTGAGTGTGGAAAACTA 58.027 39.130 2.05 0.00 31.60 2.24
430 1768 9.233649 TGGAAAACTAAAAACTAGAGAAACACA 57.766 29.630 0.00 0.00 0.00 3.72
446 2071 1.626321 ACACATGGGGATCAACGTGTA 59.374 47.619 11.84 0.00 41.36 2.90
547 2172 4.994852 TCAATACTATAGTCCAATTGCGCC 59.005 41.667 9.12 0.00 0.00 6.53
699 2324 9.737427 ATAATCGAGACATTATAATCGACATCC 57.263 33.333 10.25 0.00 45.83 3.51
757 2385 2.109128 CTCCCCCTCTCTCTATGTGCTA 59.891 54.545 0.00 0.00 0.00 3.49
1217 2988 8.956426 TGATGGTCTATGAAAGTAATTTTCCAC 58.044 33.333 0.00 0.00 43.72 4.02
1285 3056 9.952030 TTTTTCACATTACTAGTCATACCATGA 57.048 29.630 0.00 0.00 36.84 3.07
1379 3151 1.803334 TAACAAGTGGCTTGCCTACG 58.197 50.000 13.18 1.86 44.43 3.51
1664 3439 2.783510 AGGAAACACAAAAGAGGGGAGA 59.216 45.455 0.00 0.00 0.00 3.71
1673 3448 5.775195 CACAAAAGAGGGGAGAAAAAGGTAT 59.225 40.000 0.00 0.00 0.00 2.73
1872 3808 6.534634 AGGCTTTGTTGTCAAGTACTAGAAT 58.465 36.000 0.00 0.00 34.88 2.40
1939 3875 2.127708 CCCACTATAAGGAGCCAAGGT 58.872 52.381 0.00 0.00 0.00 3.50
2015 3951 7.601856 TGCTATTAGGCAATAAACCATAATGC 58.398 34.615 0.00 0.00 39.43 3.56
2344 4289 4.457281 CCCATGGCATCCCAACAA 57.543 55.556 6.09 0.00 46.14 2.83
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
35 36 5.369409 TCATCTTCTCCAATGCTGAGATT 57.631 39.130 0.00 0.0 38.58 2.40
41 42 1.483827 TCGCTCATCTTCTCCAATGCT 59.516 47.619 0.00 0.0 0.00 3.79
80 81 9.203163 ACTTCTGCTATACCTAAAGATGTAGTT 57.797 33.333 0.00 0.0 0.00 2.24
145 146 7.681939 ATGTGCTATCGTAAGGAAAAAGAAA 57.318 32.000 0.00 0.0 38.47 2.52
413 1751 5.701224 TCCCCATGTGTTTCTCTAGTTTTT 58.299 37.500 0.00 0.0 0.00 1.94
430 1768 3.078837 GTGTTTACACGTTGATCCCCAT 58.921 45.455 0.00 0.0 37.10 4.00
446 2071 6.772716 ACAGAGAAGTCAATAACCATGTGTTT 59.227 34.615 5.12 0.0 38.42 2.83
547 2172 0.511221 CGGTTAGACGTTGCTGTTGG 59.489 55.000 0.00 0.0 0.00 3.77
699 2324 5.448496 CCAAGTGAGAGAGTGAGATCTTACG 60.448 48.000 11.61 0.0 37.19 3.18
757 2385 6.109359 GGACTAGTTCAAATCTGCACACTAT 58.891 40.000 0.00 0.0 0.00 2.12
1285 3056 3.076032 AGGCTCCAAATCCTGGTAAAAGT 59.924 43.478 0.00 0.0 46.51 2.66
1362 3134 0.602905 GTCGTAGGCAAGCCACTTGT 60.603 55.000 14.40 0.0 42.77 3.16
1379 3151 2.999355 GACATGCTCAAAGTCCTCTGTC 59.001 50.000 0.00 0.0 0.00 3.51
1673 3448 5.193527 TCATTATCACTGATGGGAAAAGGGA 59.806 40.000 1.42 0.0 0.00 4.20
1872 3808 2.054021 TCCACCAAGATCCTTGTGTCA 58.946 47.619 6.04 0.0 0.00 3.58
1939 3875 7.994425 TTTGTTTTAAGAGGCACATCATCTA 57.006 32.000 0.00 0.0 34.25 1.98
2344 4289 4.021456 GGAATTCTTTCCCGACCAACAATT 60.021 41.667 5.23 0.0 44.96 2.32


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.