Multiple sequence alignment - TraesCS7A01G186800

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS7A01G186800 chr7A 100.000 2989 0 0 1 2989 142129293 142132281 0.000000e+00 5520
1 TraesCS7A01G186800 chr7A 98.063 2995 48 4 1 2989 140982724 140985714 0.000000e+00 5201
2 TraesCS7A01G186800 chr7A 97.743 3013 40 5 1 2989 141259893 141262901 0.000000e+00 5162
3 TraesCS7A01G186800 chr7A 97.644 3014 45 4 1 2989 141565563 141568575 0.000000e+00 5149
4 TraesCS7A01G186800 chr7A 96.966 3032 45 5 3 2989 141846366 141849395 0.000000e+00 5046
5 TraesCS7A01G186800 chr4A 81.307 1990 276 37 432 2384 588930885 588932815 0.000000e+00 1526
6 TraesCS7A01G186800 chr4A 82.934 668 67 21 2333 2989 588932808 588933439 2.600000e-155 558
7 TraesCS7A01G186800 chr4A 92.035 339 25 2 1 339 588930488 588930824 2.700000e-130 475
8 TraesCS7A01G186800 chr3D 95.798 119 5 0 318 436 182423812 182423694 3.040000e-45 193
9 TraesCS7A01G186800 chr7B 95.763 118 5 0 318 435 290001037 290000920 1.090000e-44 191
10 TraesCS7A01G186800 chr5A 95.041 121 6 0 319 439 142840312 142840432 1.090000e-44 191
11 TraesCS7A01G186800 chr3B 95.041 121 6 0 319 439 508220447 508220327 1.090000e-44 191
12 TraesCS7A01G186800 chr7D 92.366 131 9 1 318 447 89485466 89485336 5.090000e-43 185


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS7A01G186800 chr7A 142129293 142132281 2988 False 5520 5520 100.000000 1 2989 1 chr7A.!!$F5 2988
1 TraesCS7A01G186800 chr7A 140982724 140985714 2990 False 5201 5201 98.063000 1 2989 1 chr7A.!!$F1 2988
2 TraesCS7A01G186800 chr7A 141259893 141262901 3008 False 5162 5162 97.743000 1 2989 1 chr7A.!!$F2 2988
3 TraesCS7A01G186800 chr7A 141565563 141568575 3012 False 5149 5149 97.644000 1 2989 1 chr7A.!!$F3 2988
4 TraesCS7A01G186800 chr7A 141846366 141849395 3029 False 5046 5046 96.966000 3 2989 1 chr7A.!!$F4 2986
5 TraesCS7A01G186800 chr4A 588930488 588933439 2951 False 853 1526 85.425333 1 2989 3 chr4A.!!$F1 2988

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
511 513 1.200020 GTTGGGTGAGCACTTGTATGC 59.800 52.381 0.16 0.0 46.5 3.14 F
688 706 1.745087 CTGCGGCATTATCAACAACCT 59.255 47.619 1.75 0.0 0.0 3.50 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1574 1642 1.273606 TCCAAGCTTGTCGAAGGAGAG 59.726 52.381 24.35 5.76 0.0 3.20 R
2244 2329 3.960102 TGAGCAAAGAACATCCCAAACTT 59.040 39.130 0.00 0.00 0.0 2.66 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
511 513 1.200020 GTTGGGTGAGCACTTGTATGC 59.800 52.381 0.16 0.00 46.50 3.14
688 706 1.745087 CTGCGGCATTATCAACAACCT 59.255 47.619 1.75 0.00 0.00 3.50
1163 1228 3.982516 ACTATCTGAAGAGTGCCTACCA 58.017 45.455 0.00 0.00 0.00 3.25
1360 1428 4.657039 ACTACTGTGAAGGAAACCAACCTA 59.343 41.667 0.00 0.00 36.67 3.08
1370 1438 2.335316 AACCAACCTAGAAACGTGCA 57.665 45.000 0.00 0.00 0.00 4.57
1446 1514 2.890311 TGGACCATCAATTGTGTTCCAC 59.110 45.455 17.26 2.90 34.56 4.02
1574 1642 5.120208 AGGATGATGTACGCGCATTTAATAC 59.880 40.000 5.73 0.00 0.00 1.89
1987 2072 1.385915 CTGAGGGGGAATGGGGCTA 60.386 63.158 0.00 0.00 0.00 3.93
2244 2329 1.060954 TGGGCCATATGGTAGGGAAGA 60.061 52.381 22.79 0.00 37.57 2.87
2274 2359 0.874390 GTTCTTTGCTCATGCCACGA 59.126 50.000 0.00 0.00 38.71 4.35
2609 2738 4.522405 TGCTAGAGCCAATTTTTAGTTGCA 59.478 37.500 0.00 0.00 41.18 4.08
2926 3063 8.766000 TCGTAGATCTACATGTCTAGATTCTC 57.234 38.462 28.00 2.13 34.21 2.87
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
172 173 6.885918 ACACATACAATCATCCATTCTGTCAA 59.114 34.615 0.00 0.00 0.00 3.18
511 513 4.419522 AAACAACTTAAGCACATAGGCG 57.580 40.909 1.29 0.00 39.27 5.52
688 706 6.693315 GCTTAACAGCAATTACCAGGATAA 57.307 37.500 0.00 0.00 46.49 1.75
987 1010 5.337491 GGCTTGATCCATTCCTTAAAAGCAA 60.337 40.000 8.70 0.00 40.35 3.91
1133 1198 3.449018 ACTCTTCAGATAGTTGCGACCAT 59.551 43.478 0.00 0.00 0.00 3.55
1360 1428 5.570632 TGTGAATAGTGCATGCACGTTTCT 61.571 41.667 38.60 29.00 45.28 2.52
1370 1438 4.767578 AGATGGTCTGTGAATAGTGCAT 57.232 40.909 0.00 0.00 0.00 3.96
1446 1514 7.175119 TGGTATATCAGACGAATGAACCTAGAG 59.825 40.741 12.12 0.00 31.57 2.43
1574 1642 1.273606 TCCAAGCTTGTCGAAGGAGAG 59.726 52.381 24.35 5.76 0.00 3.20
1884 1963 4.038804 AGCTCCCCTTGGCCCCTA 62.039 66.667 0.00 0.00 0.00 3.53
1987 2072 4.341783 GAGCAGGCTGCCACACCT 62.342 66.667 34.33 16.31 46.52 4.00
2244 2329 3.960102 TGAGCAAAGAACATCCCAAACTT 59.040 39.130 0.00 0.00 0.00 2.66
2274 2359 5.785940 ACTGTAAGAATAGGAGGACAAAGGT 59.214 40.000 0.00 0.00 37.43 3.50
2573 2700 4.141551 TGGCTCTAGCAGATTGAATGACAT 60.142 41.667 4.07 0.00 44.36 3.06
2609 2738 4.018050 AGGACATTATCTCAGGCCTGTTTT 60.018 41.667 31.58 18.82 0.00 2.43


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.