Multiple sequence alignment - TraesCS7A01G186600

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS7A01G186600 chr7A 100.000 2438 0 0 1 2438 141722135 141724572 0 4503
1 TraesCS7A01G186600 chr7A 98.606 2439 29 4 1 2438 140847744 140850178 0 4311
2 TraesCS7A01G186600 chr7A 98.443 2441 34 4 1 2438 141422192 141424631 0 4294
3 TraesCS7A01G186600 chr7A 98.401 2439 38 1 1 2438 141138312 141140750 0 4287
4 TraesCS7A01G186600 chr7A 96.846 2441 72 5 1 2438 579878970 579876532 0 4076
5 TraesCS7A01G186600 chr7A 96.847 2442 70 6 1 2438 618748472 618746034 0 4076
6 TraesCS7A01G186600 chr4A 98.195 2437 41 3 1 2436 588743271 588745705 0 4253
7 TraesCS7A01G186600 chr4A 96.803 2440 72 6 1 2438 81354125 81351690 0 4069
8 TraesCS7A01G186600 chr6A 96.924 2438 69 6 1 2436 73419158 73421591 0 4082
9 TraesCS7A01G186600 chr3A 96.765 2442 73 5 1 2438 576841485 576839046 0 4067


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS7A01G186600 chr7A 141722135 141724572 2437 False 4503 4503 100.000 1 2438 1 chr7A.!!$F4 2437
1 TraesCS7A01G186600 chr7A 140847744 140850178 2434 False 4311 4311 98.606 1 2438 1 chr7A.!!$F1 2437
2 TraesCS7A01G186600 chr7A 141422192 141424631 2439 False 4294 4294 98.443 1 2438 1 chr7A.!!$F3 2437
3 TraesCS7A01G186600 chr7A 141138312 141140750 2438 False 4287 4287 98.401 1 2438 1 chr7A.!!$F2 2437
4 TraesCS7A01G186600 chr7A 579876532 579878970 2438 True 4076 4076 96.846 1 2438 1 chr7A.!!$R1 2437
5 TraesCS7A01G186600 chr7A 618746034 618748472 2438 True 4076 4076 96.847 1 2438 1 chr7A.!!$R2 2437
6 TraesCS7A01G186600 chr4A 588743271 588745705 2434 False 4253 4253 98.195 1 2436 1 chr4A.!!$F1 2435
7 TraesCS7A01G186600 chr4A 81351690 81354125 2435 True 4069 4069 96.803 1 2438 1 chr4A.!!$R1 2437
8 TraesCS7A01G186600 chr6A 73419158 73421591 2433 False 4082 4082 96.924 1 2436 1 chr6A.!!$F1 2435
9 TraesCS7A01G186600 chr3A 576839046 576841485 2439 True 4067 4067 96.765 1 2438 1 chr3A.!!$R1 2437

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1297 1302 3.833559 ACACCTCCTGGATTTCCATTT 57.166 42.857 0.0 0.0 46.46 2.32 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2387 2401 1.753956 AAATTGACAACGACTTGCGC 58.246 45.0 0.0 0.0 46.04 6.09 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
1297 1302 3.833559 ACACCTCCTGGATTTCCATTT 57.166 42.857 0.00 0.0 46.46 2.32
1355 1360 1.828660 GGGCGATTCTCTCCTCCGA 60.829 63.158 0.00 0.0 0.00 4.55
1562 1567 4.410400 CCTTCCAGCCCGGTGTCC 62.410 72.222 0.00 0.0 35.57 4.02
2029 2038 9.344772 TGTACAAAAGCTTGGTAAGATTTAAGA 57.655 29.630 11.56 0.0 45.50 2.10
2157 2167 0.109597 CAGCCCAGCAAAATCGTGTC 60.110 55.000 0.00 0.0 0.00 3.67
2387 2401 1.508088 GCCAATTGGTCGAAGCCAG 59.492 57.895 25.19 0.0 40.01 4.85
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
1297 1302 0.976641 ATCAACCTCAAGACCTGCGA 59.023 50.000 0.00 0.00 0.00 5.10
1355 1360 3.485463 TCAACTTGTCCTTGTCCGATT 57.515 42.857 0.00 0.00 0.00 3.34
1449 1454 3.005539 GTCCAGCCCCAGAGCAGA 61.006 66.667 0.00 0.00 34.23 4.26
1562 1567 2.100631 CGACCAGTAAGCAAGCGGG 61.101 63.158 0.00 0.00 0.00 6.13
1613 1618 1.272147 GGGTCCAGTGAAGCCTTCATT 60.272 52.381 10.87 3.15 42.47 2.57
2157 2167 4.158489 GGCCATTTGCACTTTCTCGAAAG 61.158 47.826 15.76 15.76 44.00 2.62
2387 2401 1.753956 AAATTGACAACGACTTGCGC 58.246 45.000 0.00 0.00 46.04 6.09


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.