Multiple sequence alignment - TraesCS7A01G186500

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS7A01G186500 chr7A 100.000 2288 0 0 1 2288 141312580 141310293 0.000000e+00 4226
1 TraesCS7A01G186500 chr7A 98.122 2290 35 3 1 2288 140768966 140766683 0.000000e+00 3984
2 TraesCS7A01G186500 chr7A 98.032 2287 42 1 2 2288 141058408 141056125 0.000000e+00 3971
3 TraesCS7A01G186500 chr7A 97.253 2293 36 2 1 2288 141652942 141650672 0.000000e+00 3860
4 TraesCS7A01G186500 chr7A 98.126 1868 34 1 1 1867 141903682 141901815 0.000000e+00 3254
5 TraesCS7A01G186500 chr7A 97.624 463 11 0 1826 2288 141901814 141901352 0.000000e+00 795
6 TraesCS7A01G186500 chr4A 98.077 2288 44 0 1 2288 588660109 588657822 0.000000e+00 3982
7 TraesCS7A01G186500 chr2D 92.782 1718 110 9 3 1713 591013982 591015692 0.000000e+00 2473
8 TraesCS7A01G186500 chr1A 92.811 1711 113 9 4 1709 46320932 46319227 0.000000e+00 2470
9 TraesCS7A01G186500 chr1A 92.694 1711 114 8 4 1709 46224668 46222964 0.000000e+00 2457
10 TraesCS7A01G186500 chr1A 92.344 1711 120 8 4 1709 46268618 46266914 0.000000e+00 2423
11 TraesCS7A01G186500 chr4D 93.151 292 11 3 2000 2288 13344928 13345213 9.770000e-114 420
12 TraesCS7A01G186500 chr4D 93.421 76 5 0 2119 2194 13357306 13357381 1.860000e-21 113
13 TraesCS7A01G186500 chr4D 88.636 88 2 3 2000 2079 13357216 13357303 1.450000e-17 100
14 TraesCS7A01G186500 chr6A 85.223 291 10 9 2001 2288 201645705 201645445 3.750000e-68 268
15 TraesCS7A01G186500 chr7D 91.667 144 12 0 1709 1852 426987879 426987736 1.390000e-47 200


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS7A01G186500 chr7A 141310293 141312580 2287 True 4226.0 4226 100.000 1 2288 1 chr7A.!!$R3 2287
1 TraesCS7A01G186500 chr7A 140766683 140768966 2283 True 3984.0 3984 98.122 1 2288 1 chr7A.!!$R1 2287
2 TraesCS7A01G186500 chr7A 141056125 141058408 2283 True 3971.0 3971 98.032 2 2288 1 chr7A.!!$R2 2286
3 TraesCS7A01G186500 chr7A 141650672 141652942 2270 True 3860.0 3860 97.253 1 2288 1 chr7A.!!$R4 2287
4 TraesCS7A01G186500 chr7A 141901352 141903682 2330 True 2024.5 3254 97.875 1 2288 2 chr7A.!!$R5 2287
5 TraesCS7A01G186500 chr4A 588657822 588660109 2287 True 3982.0 3982 98.077 1 2288 1 chr4A.!!$R1 2287
6 TraesCS7A01G186500 chr2D 591013982 591015692 1710 False 2473.0 2473 92.782 3 1713 1 chr2D.!!$F1 1710
7 TraesCS7A01G186500 chr1A 46319227 46320932 1705 True 2470.0 2470 92.811 4 1709 1 chr1A.!!$R3 1705
8 TraesCS7A01G186500 chr1A 46222964 46224668 1704 True 2457.0 2457 92.694 4 1709 1 chr1A.!!$R1 1705
9 TraesCS7A01G186500 chr1A 46266914 46268618 1704 True 2423.0 2423 92.344 4 1709 1 chr1A.!!$R2 1705

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
984 993 0.400213 AGGTCATCCTTGCACCGAAA 59.6 50.0 0.0 0.0 42.12 3.46 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2082 2141 2.058057 CTTGCATGGTTTGTTTACCGC 58.942 47.619 0.0 0.0 41.28 5.68 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
74 75 2.435586 ATCGTCGTCGTCCTCGGT 60.436 61.111 1.33 0.00 38.33 4.69
514 518 1.850345 CCCTCCAGCCAATACCCTAAA 59.150 52.381 0.00 0.00 0.00 1.85
640 644 4.222145 GGTGAGTAAATATAGGGGCGATGA 59.778 45.833 0.00 0.00 0.00 2.92
984 993 0.400213 AGGTCATCCTTGCACCGAAA 59.600 50.000 0.00 0.00 42.12 3.46
1342 1356 8.845227 TCTGCTTTGAACTGTTTATGTTTATGA 58.155 29.630 0.00 0.00 0.00 2.15
1608 1625 0.320073 CCATGCAGGCAACCAAACAG 60.320 55.000 0.00 0.00 37.17 3.16
2042 2101 3.222603 AGAACTTGCAAGAAACCGGAAT 58.777 40.909 32.50 3.89 0.00 3.01
2082 2141 1.488393 GTCCTCCCAGAATCTTCCCAG 59.512 57.143 0.00 0.00 0.00 4.45
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
483 487 1.857638 GCTGGAGGGCCTTCTTCCTT 61.858 60.000 14.33 0.0 32.74 3.36
514 518 1.156095 CCAAAGCCAACCCCTTCCT 59.844 57.895 0.00 0.0 0.00 3.36
640 644 3.181423 ACTGTCACTCTTCTCCTCCTCTT 60.181 47.826 0.00 0.0 0.00 2.85
794 798 3.165071 CATTAGGTGAAGGGGTTGCTTT 58.835 45.455 0.00 0.0 0.00 3.51
842 846 2.602267 TTCGGGTCTTCCTCGGCA 60.602 61.111 0.00 0.0 0.00 5.69
984 993 0.682209 GCATGGGGATGCACTCAAGT 60.682 55.000 2.14 0.0 46.25 3.16
1403 1417 7.652909 CAGAGCAGAGTATAAAAAGAGGATCAG 59.347 40.741 0.00 0.0 37.82 2.90
1540 1556 2.493278 GCCTGCATGTTAGTGGACAAAT 59.507 45.455 0.00 0.0 32.47 2.32
2082 2141 2.058057 CTTGCATGGTTTGTTTACCGC 58.942 47.619 0.00 0.0 41.28 5.68


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.