Multiple sequence alignment - TraesCS7A01G186400

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS7A01G186400 chr7A 100.000 7137 0 0 1 7137 141302350 141309486 0.000000e+00 13180.0
1 TraesCS7A01G186400 chr7A 99.152 6129 41 5 716 6836 140759382 140765507 0.000000e+00 11020.0
2 TraesCS7A01G186400 chr7A 99.145 6083 34 5 1072 7137 141048618 141054699 0.000000e+00 10929.0
3 TraesCS7A01G186400 chr7A 98.653 3785 30 8 1 3765 141893088 141896871 0.000000e+00 6687.0
4 TraesCS7A01G186400 chr7A 99.172 3381 18 3 3767 7137 141897284 141900664 0.000000e+00 6080.0
5 TraesCS7A01G186400 chr7A 99.347 3062 14 2 2453 5509 141644789 141647849 0.000000e+00 5539.0
6 TraesCS7A01G186400 chr7A 98.206 2062 9 4 1 2035 141642367 141644427 0.000000e+00 3578.0
7 TraesCS7A01G186400 chr7A 99.473 1519 7 1 5495 7013 141648002 141649519 0.000000e+00 2760.0
8 TraesCS7A01G186400 chr7A 97.989 746 11 3 1 742 141047315 141048060 0.000000e+00 1291.0
9 TraesCS7A01G186400 chr7A 98.553 691 8 1 1 689 140758166 140758856 0.000000e+00 1219.0
10 TraesCS7A01G186400 chr7A 97.222 324 6 3 718 1041 141048297 141048617 5.200000e-151 545.0
11 TraesCS7A01G186400 chr7A 100.000 153 0 0 7471 7623 141309820 141309972 4.500000e-72 283.0
12 TraesCS7A01G186400 chr7A 99.346 153 1 0 7471 7623 141650199 141650351 2.090000e-70 278.0
13 TraesCS7A01G186400 chr7A 99.346 153 1 0 7471 7623 141900879 141901031 2.090000e-70 278.0
14 TraesCS7A01G186400 chr7A 98.693 153 2 0 7471 7623 140766210 140766362 9.750000e-69 272.0
15 TraesCS7A01G186400 chr7A 97.386 153 4 0 7471 7623 141055652 141055804 2.110000e-65 261.0
16 TraesCS7A01G186400 chr7A 100.000 130 0 0 5280 5409 626604970 626605099 2.750000e-59 241.0
17 TraesCS7A01G186400 chr7A 97.810 137 3 0 5280 5416 222942450 222942314 3.560000e-58 237.0
18 TraesCS7A01G186400 chr6A 97.354 4233 91 8 1063 5282 201638501 201642725 0.000000e+00 7177.0
19 TraesCS7A01G186400 chr6A 96.473 1758 35 10 5405 7137 201642723 201644478 0.000000e+00 2878.0
20 TraesCS7A01G186400 chr6A 95.620 137 6 0 7471 7607 201644918 201645054 3.580000e-53 220.0
21 TraesCS7A01G186400 chr4B 95.580 3054 92 22 269 3310 24068629 24065607 0.000000e+00 4852.0
22 TraesCS7A01G186400 chr4B 97.260 1168 17 7 3310 4466 24065496 24064333 0.000000e+00 1965.0
23 TraesCS7A01G186400 chr4B 91.579 190 14 2 5095 5282 21479203 21479014 2.110000e-65 261.0
24 TraesCS7A01G186400 chr4D 95.065 3080 71 17 267 3310 13353092 13350058 0.000000e+00 4771.0
25 TraesCS7A01G186400 chr4D 97.177 1984 43 7 3310 5282 13349992 13348011 0.000000e+00 3341.0
26 TraesCS7A01G186400 chr4D 97.042 1758 22 5 5405 7137 13348017 13346265 0.000000e+00 2931.0
27 TraesCS7A01G186400 chr4D 93.996 533 22 9 267 790 13363550 13363019 0.000000e+00 798.0
28 TraesCS7A01G186400 chr4D 91.603 262 19 2 1 261 114078318 114078577 7.270000e-95 359.0
29 TraesCS7A01G186400 chr4D 99.320 147 1 0 7477 7623 13345729 13345583 4.530000e-67 267.0
30 TraesCS7A01G186400 chr4D 93.651 63 4 0 5712 5774 12020084 12020146 2.260000e-15 95.3
31 TraesCS7A01G186400 chr3B 93.793 3029 109 32 307 3310 454648883 454651857 0.000000e+00 4479.0
32 TraesCS7A01G186400 chr3B 96.864 574 18 0 3310 3883 454651969 454652542 0.000000e+00 961.0
33 TraesCS7A01G186400 chr4A 98.391 2238 31 1 3627 5859 588653810 588656047 0.000000e+00 3928.0
34 TraesCS7A01G186400 chr4A 98.038 1478 22 5 2159 3632 588643226 588644700 0.000000e+00 2562.0
35 TraesCS7A01G186400 chr4A 97.862 1450 25 4 719 2165 588633334 588634780 0.000000e+00 2501.0
36 TraesCS7A01G186400 chr4A 89.275 2014 177 13 267 2245 571359015 571361024 0.000000e+00 2486.0
37 TraesCS7A01G186400 chr4A 88.938 2016 182 14 267 2245 588584079 588586090 0.000000e+00 2449.0
38 TraesCS7A01G186400 chr4A 89.245 1999 152 24 2337 4320 588586132 588588082 0.000000e+00 2442.0
39 TraesCS7A01G186400 chr4A 98.705 1158 14 1 5980 7137 588656077 588657233 0.000000e+00 2054.0
40 TraesCS7A01G186400 chr4A 97.479 595 14 1 1 595 588599794 588600387 0.000000e+00 1014.0
41 TraesCS7A01G186400 chr4A 87.566 571 57 10 6531 7097 571363384 571363944 0.000000e+00 649.0
42 TraesCS7A01G186400 chr4A 87.215 571 59 10 6531 7097 588588453 588589013 8.340000e-179 638.0
43 TraesCS7A01G186400 chr4A 95.720 257 11 0 1 257 571302480 571302736 1.530000e-111 414.0
44 TraesCS7A01G186400 chr4A 84.282 369 33 10 5407 5774 590500372 590500028 3.410000e-88 337.0
45 TraesCS7A01G186400 chr4A 99.346 153 1 0 7471 7623 588657349 588657501 2.090000e-70 278.0
46 TraesCS7A01G186400 chr4A 91.099 191 14 3 5095 5283 590500556 590500367 9.820000e-64 255.0
47 TraesCS7A01G186400 chr4A 86.735 196 20 3 5786 5981 590499605 590499416 5.990000e-51 213.0
48 TraesCS7A01G186400 chr4A 89.209 139 12 1 7472 7607 588589199 588589337 3.660000e-38 171.0
49 TraesCS7A01G186400 chr4A 91.129 124 11 0 7484 7607 571364260 571364383 1.320000e-37 169.0
50 TraesCS7A01G186400 chr4A 100.000 34 0 0 5994 6027 588656046 588656079 6.390000e-06 63.9
51 TraesCS7A01G186400 chr5D 92.308 260 19 1 1 259 451733878 451733619 1.210000e-97 368.0
52 TraesCS7A01G186400 chr7D 91.506 259 22 0 1 259 330781623 330781881 2.620000e-94 357.0
53 TraesCS7A01G186400 chr5A 100.000 128 0 0 5279 5406 279670549 279670422 3.560000e-58 237.0
54 TraesCS7A01G186400 chr5A 97.794 136 2 1 5275 5410 64544594 64544460 4.600000e-57 233.0


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS7A01G186400 chr7A 141302350 141309972 7622 False 6731.500000 13180 100.000000 1 7623 2 chr7A.!!$F4 7622
1 TraesCS7A01G186400 chr7A 141893088 141901031 7943 False 4348.333333 6687 99.057000 1 7623 3 chr7A.!!$F6 7622
2 TraesCS7A01G186400 chr7A 140758166 140766362 8196 False 4170.333333 11020 98.799333 1 7623 3 chr7A.!!$F2 7622
3 TraesCS7A01G186400 chr7A 141047315 141055804 8489 False 3256.500000 10929 97.935500 1 7623 4 chr7A.!!$F3 7622
4 TraesCS7A01G186400 chr7A 141642367 141650351 7984 False 3038.750000 5539 99.093000 1 7623 4 chr7A.!!$F5 7622
5 TraesCS7A01G186400 chr6A 201638501 201645054 6553 False 3425.000000 7177 96.482333 1063 7607 3 chr6A.!!$F1 6544
6 TraesCS7A01G186400 chr4B 24064333 24068629 4296 True 3408.500000 4852 96.420000 269 4466 2 chr4B.!!$R2 4197
7 TraesCS7A01G186400 chr4D 13345583 13353092 7509 True 2827.500000 4771 97.151000 267 7623 4 chr4D.!!$R2 7356
8 TraesCS7A01G186400 chr4D 13363019 13363550 531 True 798.000000 798 93.996000 267 790 1 chr4D.!!$R1 523
9 TraesCS7A01G186400 chr3B 454648883 454652542 3659 False 2720.000000 4479 95.328500 307 3883 2 chr3B.!!$F1 3576
10 TraesCS7A01G186400 chr4A 588643226 588644700 1474 False 2562.000000 2562 98.038000 2159 3632 1 chr4A.!!$F4 1473
11 TraesCS7A01G186400 chr4A 588633334 588634780 1446 False 2501.000000 2501 97.862000 719 2165 1 chr4A.!!$F3 1446
12 TraesCS7A01G186400 chr4A 588653810 588657501 3691 False 1580.975000 3928 99.110500 3627 7623 4 chr4A.!!$F7 3996
13 TraesCS7A01G186400 chr4A 588584079 588589337 5258 False 1425.000000 2449 88.651750 267 7607 4 chr4A.!!$F6 7340
14 TraesCS7A01G186400 chr4A 571359015 571364383 5368 False 1101.333333 2486 89.323333 267 7607 3 chr4A.!!$F5 7340
15 TraesCS7A01G186400 chr4A 588599794 588600387 593 False 1014.000000 1014 97.479000 1 595 1 chr4A.!!$F2 594
16 TraesCS7A01G186400 chr4A 590499416 590500556 1140 True 268.333333 337 87.372000 5095 5981 3 chr4A.!!$R1 886

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
128 129 0.033796 CATGAGGCACCCACAAGGAT 60.034 55.000 0.00 0.00 39.89 3.24 F
1326 2113 2.080654 TTGTTTACAAAGCAGGGCCT 57.919 45.000 0.00 0.00 32.11 5.19 F
2035 2832 5.703130 ACTTGGAAGAAATTGACTAGTGCTC 59.297 40.000 0.00 0.00 0.00 4.26 F
4141 5496 1.552792 GAGCTTCTAGCACTGGGTCTT 59.447 52.381 1.09 0.00 45.56 3.01 F
4627 6120 6.183360 CGAGGGATCTACTTTGACTTCCATTA 60.183 42.308 0.00 0.00 0.00 1.90 F
6620 8707 5.449588 GCCACAGAAATCGACAATGATCATT 60.450 40.000 15.36 15.36 0.00 2.57 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2035 2832 3.932710 TCAAGCAAGCTTAATGTAGGACG 59.067 43.478 7.03 0.0 34.50 4.79 R
2959 3764 2.520020 CGGGCATGATGGGCACAT 60.520 61.111 0.00 0.0 40.85 3.21 R
4627 6120 8.568794 GCGGCTAAAAATAATAAGAATTCCTCT 58.431 33.333 0.65 0.0 35.13 3.69 R
5097 6601 1.561076 TGCAGTAGGTGATGCTTGGAT 59.439 47.619 0.00 0.0 42.98 3.41 R
6620 8707 2.803133 GCACATCGGCTGCATTAGACTA 60.803 50.000 0.50 0.0 34.56 2.59 R
7573 11265 3.070446 CCACATATGCCATTGCCTCAATT 59.930 43.478 1.58 0.0 36.33 2.32 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
44 45 4.398319 ACAGAGTCCAAACGGAATGAAAT 58.602 39.130 0.00 0.00 33.16 2.17
64 65 8.735303 TGAAATTTTCGCGATGATTTTTCTTA 57.265 26.923 22.81 10.77 0.00 2.10
128 129 0.033796 CATGAGGCACCCACAAGGAT 60.034 55.000 0.00 0.00 39.89 3.24
1326 2113 2.080654 TTGTTTACAAAGCAGGGCCT 57.919 45.000 0.00 0.00 32.11 5.19
2035 2832 5.703130 ACTTGGAAGAAATTGACTAGTGCTC 59.297 40.000 0.00 0.00 0.00 4.26
2959 3764 2.046988 CATGACGCACTCCAGGCA 60.047 61.111 0.00 0.00 0.00 4.75
3781 5125 4.991056 ACGCGCTAGAATTCATCATATTGT 59.009 37.500 5.73 0.00 0.00 2.71
4141 5496 1.552792 GAGCTTCTAGCACTGGGTCTT 59.447 52.381 1.09 0.00 45.56 3.01
4627 6120 6.183360 CGAGGGATCTACTTTGACTTCCATTA 60.183 42.308 0.00 0.00 0.00 1.90
6620 8707 5.449588 GCCACAGAAATCGACAATGATCATT 60.450 40.000 15.36 15.36 0.00 2.57
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
44 45 6.072948 TGGTCTAAGAAAAATCATCGCGAAAA 60.073 34.615 15.24 4.18 0.00 2.29
64 65 3.008485 GTCCTCTGGATGTCTTTTGGTCT 59.992 47.826 0.00 0.00 32.73 3.85
1326 2113 4.161189 AGAAGATGAAGAGAGGCGAAATCA 59.839 41.667 0.00 0.00 0.00 2.57
2035 2832 3.932710 TCAAGCAAGCTTAATGTAGGACG 59.067 43.478 7.03 0.00 34.50 4.79
2909 3714 3.302347 CTGCGGAAGAAGGGCGAGT 62.302 63.158 0.00 0.00 31.05 4.18
2959 3764 2.520020 CGGGCATGATGGGCACAT 60.520 61.111 0.00 0.00 40.85 3.21
4627 6120 8.568794 GCGGCTAAAAATAATAAGAATTCCTCT 58.431 33.333 0.65 0.00 35.13 3.69
5097 6601 1.561076 TGCAGTAGGTGATGCTTGGAT 59.439 47.619 0.00 0.00 42.98 3.41
6620 8707 2.803133 GCACATCGGCTGCATTAGACTA 60.803 50.000 0.50 0.00 34.56 2.59
7059 9775 3.245122 ACCTCCACACCCATTTTCGTATT 60.245 43.478 0.00 0.00 0.00 1.89
7573 11265 3.070446 CCACATATGCCATTGCCTCAATT 59.930 43.478 1.58 0.00 36.33 2.32


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.