Multiple sequence alignment - TraesCS7A01G186300

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS7A01G186300 chr7A 100.000 2288 0 0 1 2288 141058409 141056122 0.000000e+00 4226.0
1 TraesCS7A01G186300 chr7A 98.035 2290 42 1 2 2288 141312579 141310290 0.000000e+00 3976.0
2 TraesCS7A01G186300 chr7A 97.993 2292 35 4 2 2288 140768965 140766680 0.000000e+00 3967.0
3 TraesCS7A01G186300 chr7A 97.124 2295 36 3 2 2288 141652941 141650669 0.000000e+00 3845.0
4 TraesCS7A01G186300 chr7A 98.447 1867 28 1 2 1867 141903681 141901815 0.000000e+00 3286.0
5 TraesCS7A01G186300 chr7A 96.352 466 14 1 1826 2288 141901814 141901349 0.000000e+00 763.0
6 TraesCS7A01G186300 chr4A 97.773 2290 48 1 2 2288 588660108 588657819 0.000000e+00 3943.0
7 TraesCS7A01G186300 chr1A 93.103 1711 108 9 4 1709 46320932 46319227 0.000000e+00 2497.0
8 TraesCS7A01G186300 chr1A 92.870 1711 111 8 4 1709 46224668 46222964 0.000000e+00 2473.0
9 TraesCS7A01G186300 chr1A 92.636 1711 115 8 4 1709 46268618 46266914 0.000000e+00 2451.0
10 TraesCS7A01G186300 chr2D 92.841 1718 109 9 3 1713 591013982 591015692 0.000000e+00 2479.0
11 TraesCS7A01G186300 chr4D 93.333 270 11 3 2000 2262 13344928 13345197 2.130000e-105 392.0
12 TraesCS7A01G186300 chr4D 92.105 76 6 0 2116 2191 13357306 13357381 8.640000e-20 108.0
13 TraesCS7A01G186300 chr4D 83.871 93 4 4 2000 2081 13357216 13357308 6.780000e-11 78.7
14 TraesCS7A01G186300 chr6A 84.758 269 10 6 2001 2262 201645705 201645461 8.170000e-60 241.0
15 TraesCS7A01G186300 chr7D 90.972 144 13 0 1709 1852 426987879 426987736 6.450000e-46 195.0


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS7A01G186300 chr7A 141056122 141058409 2287 True 4226.0 4226 100.0000 1 2288 1 chr7A.!!$R2 2287
1 TraesCS7A01G186300 chr7A 141310290 141312579 2289 True 3976.0 3976 98.0350 2 2288 1 chr7A.!!$R3 2286
2 TraesCS7A01G186300 chr7A 140766680 140768965 2285 True 3967.0 3967 97.9930 2 2288 1 chr7A.!!$R1 2286
3 TraesCS7A01G186300 chr7A 141650669 141652941 2272 True 3845.0 3845 97.1240 2 2288 1 chr7A.!!$R4 2286
4 TraesCS7A01G186300 chr7A 141901349 141903681 2332 True 2024.5 3286 97.3995 2 2288 2 chr7A.!!$R5 2286
5 TraesCS7A01G186300 chr4A 588657819 588660108 2289 True 3943.0 3943 97.7730 2 2288 1 chr4A.!!$R1 2286
6 TraesCS7A01G186300 chr1A 46319227 46320932 1705 True 2497.0 2497 93.1030 4 1709 1 chr1A.!!$R3 1705
7 TraesCS7A01G186300 chr1A 46222964 46224668 1704 True 2473.0 2473 92.8700 4 1709 1 chr1A.!!$R1 1705
8 TraesCS7A01G186300 chr1A 46266914 46268618 1704 True 2451.0 2451 92.6360 4 1709 1 chr1A.!!$R2 1705
9 TraesCS7A01G186300 chr2D 591013982 591015692 1710 False 2479.0 2479 92.8410 3 1713 1 chr2D.!!$F1 1710

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
939 948 1.563924 ACTACGGCCACTACCATCAA 58.436 50.0 2.24 0.0 0.0 2.57 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2046 2108 1.272147 GGGAGGACTTTGTCAGGCAAT 60.272 52.381 0.0 0.0 36.89 3.56 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
273 277 3.072622 ACCACTTCTTCCTCTGTTTACCC 59.927 47.826 0.00 0.0 0.00 3.69
319 323 2.905075 CCCAGCGAATGATGTCAACTA 58.095 47.619 0.00 0.0 0.00 2.24
403 407 4.943705 TGAACACTGCATTAGATTCCTTCC 59.056 41.667 0.00 0.0 0.00 3.46
939 948 1.563924 ACTACGGCCACTACCATCAA 58.436 50.000 2.24 0.0 0.00 2.57
1067 1076 0.468226 AAGCTCAGGAACAACACCGA 59.532 50.000 0.00 0.0 0.00 4.69
1594 1611 0.250858 CAGTGTGGTTCTGCCCATGA 60.251 55.000 0.00 0.0 36.74 3.07
1618 1635 3.305950 GGCAACCAAACAACATGCAGATA 60.306 43.478 0.00 0.0 38.73 1.98
1725 1742 3.316588 CGCTCCTAGAGAATCAGCTACAA 59.683 47.826 0.00 0.0 37.82 2.41
1909 1968 1.543065 GGCCACCATGCAACCATTGA 61.543 55.000 0.00 0.0 0.00 2.57
2046 2108 3.118956 ACTTGCAAACCGAAAATGGTCAA 60.119 39.130 0.00 0.0 42.89 3.18
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
0 1 4.479993 GCCAGCAGCTCGACCCAT 62.480 66.667 0.00 0.00 38.99 4.00
857 861 2.750350 CCACCCTCAGGCGTCTTT 59.250 61.111 0.00 0.00 36.11 2.52
939 948 0.548682 AGTGAGTTGGGCCATCCTCT 60.549 55.000 25.35 14.97 36.20 3.69
1067 1076 1.821061 CGTCACCTTCCAGGAGCAGT 61.821 60.000 0.00 0.00 37.67 4.40
1594 1611 1.209019 TGCATGTTGTTTGGTTGCCTT 59.791 42.857 0.00 0.00 32.39 4.35
2046 2108 1.272147 GGGAGGACTTTGTCAGGCAAT 60.272 52.381 0.00 0.00 36.89 3.56


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.