Multiple sequence alignment - TraesCS7A01G186100

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS7A01G186100 chr7A 100.000 2495 0 0 1 2495 140756638 140754144 0.000000e+00 4608
1 TraesCS7A01G186100 chr7A 98.396 2494 36 3 4 2495 141891543 141889052 0.000000e+00 4381
2 TraesCS7A01G186100 chr7A 98.197 2496 36 5 1 2495 141300811 141298324 0.000000e+00 4351
3 TraesCS7A01G186100 chr7A 97.818 2337 46 4 160 2495 141630622 141628290 0.000000e+00 4028
4 TraesCS7A01G186100 chr7A 98.172 1860 32 2 160 2018 141022969 141021111 0.000000e+00 3245
5 TraesCS7A01G186100 chr7A 99.194 124 1 0 2372 2495 141021111 141020988 8.980000e-55 224
6 TraesCS7A01G186100 chr4A 98.357 2496 37 4 1 2495 588598254 588595762 0.000000e+00 4379
7 TraesCS7A01G186100 chr4A 92.344 209 14 1 2287 2495 552914892 552914686 1.880000e-76 296
8 TraesCS7A01G186100 chr7B 97.277 1763 43 4 735 2495 433300752 433302511 0.000000e+00 2985
9 TraesCS7A01G186100 chr5B 90.889 1789 145 13 711 2492 361542933 361544710 0.000000e+00 2385
10 TraesCS7A01G186100 chr2D 91.087 460 39 2 1 459 642833707 642834165 2.730000e-174 621
11 TraesCS7A01G186100 chr2D 89.655 464 42 5 1 459 431918531 431918993 9.940000e-164 586
12 TraesCS7A01G186100 chr7D 90.217 460 44 1 1 459 569024364 569023905 1.280000e-167 599
13 TraesCS7A01G186100 chr6D 89.394 462 45 3 1 459 396520299 396520759 1.660000e-161 579
14 TraesCS7A01G186100 chr3D 86.631 187 20 5 473 655 99875162 99875347 4.210000e-48 202
15 TraesCS7A01G186100 chr3D 86.813 182 15 8 481 657 528823357 528823180 7.040000e-46 195
16 TraesCS7A01G186100 chr3D 84.343 198 23 5 468 658 378569674 378569870 1.180000e-43 187
17 TraesCS7A01G186100 chr1D 86.559 186 19 5 473 654 295181359 295181542 1.510000e-47 200


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS7A01G186100 chr7A 140754144 140756638 2494 True 4608.0 4608 100.000 1 2495 1 chr7A.!!$R1 2494
1 TraesCS7A01G186100 chr7A 141889052 141891543 2491 True 4381.0 4381 98.396 4 2495 1 chr7A.!!$R4 2491
2 TraesCS7A01G186100 chr7A 141298324 141300811 2487 True 4351.0 4351 98.197 1 2495 1 chr7A.!!$R2 2494
3 TraesCS7A01G186100 chr7A 141628290 141630622 2332 True 4028.0 4028 97.818 160 2495 1 chr7A.!!$R3 2335
4 TraesCS7A01G186100 chr7A 141020988 141022969 1981 True 1734.5 3245 98.683 160 2495 2 chr7A.!!$R5 2335
5 TraesCS7A01G186100 chr4A 588595762 588598254 2492 True 4379.0 4379 98.357 1 2495 1 chr4A.!!$R2 2494
6 TraesCS7A01G186100 chr7B 433300752 433302511 1759 False 2985.0 2985 97.277 735 2495 1 chr7B.!!$F1 1760
7 TraesCS7A01G186100 chr5B 361542933 361544710 1777 False 2385.0 2385 90.889 711 2492 1 chr5B.!!$F1 1781

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
905 906 1.920325 CTCCACCAGAGGCCTTCCA 60.92 63.158 6.77 0.0 39.13 3.53 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2199 2565 1.771854 TCTTTGTTCCCTGGCACACTA 59.228 47.619 0.0 0.0 0.0 2.74 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
209 210 2.034066 CGTGAACTGGTGCCCCAT 59.966 61.111 0.00 0.00 40.90 4.00
488 489 7.299053 ACGTTCGCTTTATTTTAGTTTTTCG 57.701 32.000 0.00 0.00 0.00 3.46
790 791 2.606519 CCTCCTCGTCCCCCAACA 60.607 66.667 0.00 0.00 0.00 3.33
905 906 1.920325 CTCCACCAGAGGCCTTCCA 60.920 63.158 6.77 0.00 39.13 3.53
952 953 5.074746 ACTTCCACCAAATCCCTAGTTTT 57.925 39.130 0.00 0.00 0.00 2.43
1168 1174 0.392998 AGAAGGAATGGCGATTGCGT 60.393 50.000 7.28 4.21 44.10 5.24
1421 1427 4.202151 GGGAATGATGTGTAAGGAAATGGC 60.202 45.833 0.00 0.00 0.00 4.40
2094 2460 2.179427 CTTGATTTTGGGAAGGGGGAC 58.821 52.381 0.00 0.00 0.00 4.46
2095 2461 0.039035 TGATTTTGGGAAGGGGGACG 59.961 55.000 0.00 0.00 0.00 4.79
2096 2462 1.304962 ATTTTGGGAAGGGGGACGC 60.305 57.895 0.00 0.00 43.76 5.19
2097 2463 2.798445 ATTTTGGGAAGGGGGACGCC 62.798 60.000 0.00 0.00 44.92 5.68
2199 2565 3.447229 GGAATGGGTCGAATGAAAACCAT 59.553 43.478 0.00 0.00 37.12 3.55
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
488 489 5.334646 GGAGTGGACGTGATTAAAAGAAACC 60.335 44.000 0.0 0.0 0.00 3.27
905 906 2.665000 CGTGCCCCAGACTCACAT 59.335 61.111 0.0 0.0 0.00 3.21
1168 1174 4.947147 GCACCACACTCGCCCCAA 62.947 66.667 0.0 0.0 0.00 4.12
1421 1427 2.789213 TCTCATCTGCTAGATCCTCCG 58.211 52.381 0.0 0.0 31.32 4.63
1855 1863 1.882989 GAGCTGCCTCCACTCGTCTT 61.883 60.000 0.0 0.0 31.68 3.01
2094 2460 2.436646 AGGCTTGGATCGTTGGCG 60.437 61.111 0.0 0.0 39.92 5.69
2095 2461 3.190878 CAGGCTTGGATCGTTGGC 58.809 61.111 0.0 0.0 0.00 4.52
2199 2565 1.771854 TCTTTGTTCCCTGGCACACTA 59.228 47.619 0.0 0.0 0.00 2.74


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.