Multiple sequence alignment - TraesCS7A01G169900

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS7A01G169900 chr7A 100.000 2471 0 0 1 2471 126147083 126149553 0.000000e+00 4564.0
1 TraesCS7A01G169900 chr6A 95.916 2473 76 11 2 2471 137494900 137492450 0.000000e+00 3984.0
2 TraesCS7A01G169900 chr6A 95.652 2484 81 10 5 2471 182421814 182419341 0.000000e+00 3964.0
3 TraesCS7A01G169900 chr3B 95.664 2491 81 13 2 2471 473234226 473236710 0.000000e+00 3976.0
4 TraesCS7A01G169900 chr7B 94.574 2488 109 9 2 2471 51882344 51884823 0.000000e+00 3823.0
5 TraesCS7A01G169900 chr6B 94.494 2488 94 14 2 2471 48078044 48080506 0.000000e+00 3795.0
6 TraesCS7A01G169900 chr2A 94.456 2489 92 12 2 2471 778647331 778649792 0.000000e+00 3790.0
7 TraesCS7A01G169900 chr4B 93.936 2490 124 12 2 2471 321540574 321543056 0.000000e+00 3736.0
8 TraesCS7A01G169900 chr4B 94.447 2215 109 12 7 2214 587096940 587099147 0.000000e+00 3397.0
9 TraesCS7A01G169900 chr4B 88.655 238 9 4 2251 2471 587099150 587099386 8.710000e-70 274.0
10 TraesCS7A01G169900 chr4B 86.765 68 5 2 2407 2471 43573007 43572941 3.410000e-09 73.1
11 TraesCS7A01G169900 chr4B 86.765 68 5 2 2407 2471 43586873 43586807 3.410000e-09 73.1
12 TraesCS7A01G169900 chr3A 95.397 2281 98 6 2 2281 153361224 153363498 0.000000e+00 3624.0


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS7A01G169900 chr7A 126147083 126149553 2470 False 4564.0 4564 100.000 1 2471 1 chr7A.!!$F1 2470
1 TraesCS7A01G169900 chr6A 137492450 137494900 2450 True 3984.0 3984 95.916 2 2471 1 chr6A.!!$R1 2469
2 TraesCS7A01G169900 chr6A 182419341 182421814 2473 True 3964.0 3964 95.652 5 2471 1 chr6A.!!$R2 2466
3 TraesCS7A01G169900 chr3B 473234226 473236710 2484 False 3976.0 3976 95.664 2 2471 1 chr3B.!!$F1 2469
4 TraesCS7A01G169900 chr7B 51882344 51884823 2479 False 3823.0 3823 94.574 2 2471 1 chr7B.!!$F1 2469
5 TraesCS7A01G169900 chr6B 48078044 48080506 2462 False 3795.0 3795 94.494 2 2471 1 chr6B.!!$F1 2469
6 TraesCS7A01G169900 chr2A 778647331 778649792 2461 False 3790.0 3790 94.456 2 2471 1 chr2A.!!$F1 2469
7 TraesCS7A01G169900 chr4B 321540574 321543056 2482 False 3736.0 3736 93.936 2 2471 1 chr4B.!!$F1 2469
8 TraesCS7A01G169900 chr4B 587096940 587099386 2446 False 1835.5 3397 91.551 7 2471 2 chr4B.!!$F2 2464
9 TraesCS7A01G169900 chr3A 153361224 153363498 2274 False 3624.0 3624 95.397 2 2281 1 chr3A.!!$F1 2279

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
42 43 1.213182 AGAGCCATCTAGTCGTCCTCA 59.787 52.381 0.0 0.0 32.54 3.86 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1930 1946 0.965866 CCTCAGCACTACGAGGTGGA 60.966 60.0 12.54 4.04 43.32 4.02 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
42 43 1.213182 AGAGCCATCTAGTCGTCCTCA 59.787 52.381 0.00 0.0 32.54 3.86
208 210 2.822561 TGTTTGGTTCAAGCACTTGTGA 59.177 40.909 10.05 0.0 41.16 3.58
271 273 6.774656 ACCTGAAAATGGGAGCTATAAAGATG 59.225 38.462 0.00 0.0 0.00 2.90
363 365 7.039504 ACAATTGCAAGGATGACTTAACTGAAT 60.040 33.333 4.94 0.0 37.29 2.57
391 393 3.375299 GCTGCGAACCAGATTGAGTTAAT 59.625 43.478 0.00 0.0 44.64 1.40
448 450 7.038587 TGGTATCTAGCTTTTCTTTGTGTCCTA 60.039 37.037 0.00 0.0 0.00 2.94
701 712 3.324846 TGCAGGATCTGAAGTGTACTGTT 59.675 43.478 0.00 0.0 32.44 3.16
1468 1480 5.116084 TCCATTGCTACTTAAGAAGCCAT 57.884 39.130 10.09 0.0 37.97 4.40
1538 1552 9.522804 CAAGGTACATAGCTACTAAGAAAGAAG 57.477 37.037 0.00 0.0 33.01 2.85
1598 1613 5.401033 TGTTTGCACATTGTTGTTTATGC 57.599 34.783 0.00 0.0 32.34 3.14
1945 1961 1.478510 CAGAATCCACCTCGTAGTGCT 59.521 52.381 2.59 0.0 36.38 4.40
2290 2311 3.835478 ATAGACATAGGGCTGCTAGGA 57.165 47.619 0.00 0.0 0.00 2.94
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
0 1 2.351777 ACTGAACAGTGAGGCGCTA 58.648 52.632 7.64 0.00 40.75 4.26
42 43 2.286872 CTGCTTCTCGATGGCAAGAAT 58.713 47.619 0.86 0.00 35.49 2.40
80 81 8.838649 AAATGATGTTTAGCCCTAACCTAATT 57.161 30.769 0.00 0.00 0.00 1.40
227 229 7.194112 TCAGGTCATGATTAATCACAGGTAA 57.806 36.000 20.19 1.75 40.03 2.85
271 273 3.259123 AGAATTTGTTTCTCACCATGGCC 59.741 43.478 13.04 0.00 40.86 5.36
363 365 4.702831 TCAATCTGGTTCGCAGCAATATA 58.297 39.130 0.00 0.00 0.00 0.86
448 450 8.874744 ATCTCAAGGCAGCAACATATATAAAT 57.125 30.769 0.00 0.00 0.00 1.40
701 712 4.394729 AGTGGAGGTTGATAAGCGAAAAA 58.605 39.130 0.00 0.00 0.00 1.94
944 956 0.242017 GAGATGTGTGGTTGCTTGCC 59.758 55.000 0.00 0.00 0.00 4.52
1208 1220 7.160547 TCCATACGAAGTTGACTTATACACA 57.839 36.000 0.00 0.00 37.78 3.72
1468 1480 2.091720 TGCAGTCCTCGGGTATAGGTTA 60.092 50.000 0.00 0.00 35.48 2.85
1598 1613 3.589988 ACGCTCCAAGACAATTCTACAG 58.410 45.455 0.00 0.00 0.00 2.74
1847 1863 2.556189 TCGCATTTGTGTAACCAGCATT 59.444 40.909 0.00 0.00 34.36 3.56
1930 1946 0.965866 CCTCAGCACTACGAGGTGGA 60.966 60.000 12.54 4.04 43.32 4.02
1945 1961 3.792401 CCGCATGTTGTAATACTCCTCA 58.208 45.455 0.00 0.00 0.00 3.86


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.