Multiple sequence alignment - TraesCS7A01G165100

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS7A01G165100 chr7A 100.000 2183 0 0 1 2183 120911765 120913947 0 4032
1 TraesCS7A01G165100 chr7A 99.039 2185 19 1 1 2183 4953907 4951723 0 3917
2 TraesCS7A01G165100 chr7A 98.992 2183 22 0 1 2183 671946609 671948791 0 3910
3 TraesCS7A01G165100 chr7A 97.939 2183 45 0 1 2183 734951866 734954048 0 3783
4 TraesCS7A01G165100 chr7A 97.939 2183 44 1 1 2183 211358758 211360939 0 3781
5 TraesCS7A01G165100 chr7B 99.084 2183 20 0 1 2183 743080246 743078064 0 3921
6 TraesCS7A01G165100 chr5A 99.038 2183 21 0 1 2183 16608864 16611046 0 3916
7 TraesCS7A01G165100 chr5A 98.992 2183 22 0 1 2183 600285664 600287846 0 3910
8 TraesCS7A01G165100 chr5A 98.946 2183 22 1 1 2183 300062921 300060740 0 3903
9 TraesCS7A01G165100 chr6B 98.763 2183 27 0 1 2183 394436880 394439062 0 3882


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS7A01G165100 chr7A 120911765 120913947 2182 False 4032 4032 100.000 1 2183 1 chr7A.!!$F1 2182
1 TraesCS7A01G165100 chr7A 4951723 4953907 2184 True 3917 3917 99.039 1 2183 1 chr7A.!!$R1 2182
2 TraesCS7A01G165100 chr7A 671946609 671948791 2182 False 3910 3910 98.992 1 2183 1 chr7A.!!$F3 2182
3 TraesCS7A01G165100 chr7A 734951866 734954048 2182 False 3783 3783 97.939 1 2183 1 chr7A.!!$F4 2182
4 TraesCS7A01G165100 chr7A 211358758 211360939 2181 False 3781 3781 97.939 1 2183 1 chr7A.!!$F2 2182
5 TraesCS7A01G165100 chr7B 743078064 743080246 2182 True 3921 3921 99.084 1 2183 1 chr7B.!!$R1 2182
6 TraesCS7A01G165100 chr5A 16608864 16611046 2182 False 3916 3916 99.038 1 2183 1 chr5A.!!$F1 2182
7 TraesCS7A01G165100 chr5A 600285664 600287846 2182 False 3910 3910 98.992 1 2183 1 chr5A.!!$F2 2182
8 TraesCS7A01G165100 chr5A 300060740 300062921 2181 True 3903 3903 98.946 1 2183 1 chr5A.!!$R1 2182
9 TraesCS7A01G165100 chr6B 394436880 394439062 2182 False 3882 3882 98.763 1 2183 1 chr6B.!!$F1 2182

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
453 454 2.356535 GGCATCACTTCCTTCACTCCAT 60.357 50.0 0.0 0.0 0.0 3.41 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2014 2017 2.411701 CGAACGGCGCATCCTAGA 59.588 61.111 10.83 0.0 0.0 2.43 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
453 454 2.356535 GGCATCACTTCCTTCACTCCAT 60.357 50.000 0.00 0.00 0.00 3.41
872 875 2.783228 ACGGCAAGGAAAAACGTCA 58.217 47.368 0.00 0.00 31.39 4.35
1180 1183 4.895297 CACCATCCAATTTAGGCATTAGGT 59.105 41.667 0.00 0.00 0.00 3.08
1969 1972 9.853177 CACTAGTATTTTATGGATTCTTTCCCT 57.147 33.333 0.00 0.00 44.77 4.20
2051 2054 3.318275 TCGTGATAAGCTTATCCGCTTCT 59.682 43.478 33.35 7.73 46.68 2.85
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
453 454 3.327172 ACGATCTTATCCCGAGTCCTCTA 59.673 47.826 0.00 0.00 0.00 2.43
758 761 2.553247 GGGATGGATAGTTGCCCTTAGC 60.553 54.545 0.00 0.00 44.14 3.09
1180 1183 5.584913 AGTTCCTGGATTGAGAGAGTTCTA 58.415 41.667 0.00 0.00 32.53 2.10
1284 1287 6.233905 TCGAAATGACTTGATTATCCCTCA 57.766 37.500 0.00 0.00 0.00 3.86
1388 1391 3.576932 ATTGGTACGCCACGCACGA 62.577 57.895 0.00 0.00 46.01 4.35
1428 1431 7.808672 TTGTAGAAACACTTTCGAAAGAACAA 58.191 30.769 37.54 27.33 42.34 2.83
1969 1972 5.046591 CCTTTTGGAGATGACTACACTACCA 60.047 44.000 0.00 0.00 44.07 3.25
2014 2017 2.411701 CGAACGGCGCATCCTAGA 59.588 61.111 10.83 0.00 0.00 2.43


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.