Multiple sequence alignment - TraesCS7A01G164500

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS7A01G164500 chr7A 100.000 2440 0 0 1 2440 120839558 120841997 0 4506
1 TraesCS7A01G164500 chr7A 98.691 2444 28 3 1 2440 60280915 60278472 0 4333
2 TraesCS7A01G164500 chr5A 98.979 2448 17 4 1 2440 19247241 19249688 0 4375
3 TraesCS7A01G164500 chr7D 98.773 2445 23 4 1 2440 381925603 381923161 0 4342
4 TraesCS7A01G164500 chr7D 98.773 2445 21 6 1 2440 382051681 382049241 0 4340
5 TraesCS7A01G164500 chr7D 98.732 2445 23 5 1 2440 203501601 203499160 0 4337
6 TraesCS7A01G164500 chr1A 98.772 2443 24 4 1 2440 498689625 498692064 0 4340
7 TraesCS7A01G164500 chr7B 98.732 2444 25 4 1 2440 716877179 716879620 0 4337
8 TraesCS7A01G164500 chr7B 98.528 2446 29 5 1 2440 742991047 742988603 0 4311
9 TraesCS7A01G164500 chr2B 98.200 2445 36 5 1 2439 112842637 112840195 0 4265


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS7A01G164500 chr7A 120839558 120841997 2439 False 4506 4506 100.000 1 2440 1 chr7A.!!$F1 2439
1 TraesCS7A01G164500 chr7A 60278472 60280915 2443 True 4333 4333 98.691 1 2440 1 chr7A.!!$R1 2439
2 TraesCS7A01G164500 chr5A 19247241 19249688 2447 False 4375 4375 98.979 1 2440 1 chr5A.!!$F1 2439
3 TraesCS7A01G164500 chr7D 381923161 381925603 2442 True 4342 4342 98.773 1 2440 1 chr7D.!!$R2 2439
4 TraesCS7A01G164500 chr7D 382049241 382051681 2440 True 4340 4340 98.773 1 2440 1 chr7D.!!$R3 2439
5 TraesCS7A01G164500 chr7D 203499160 203501601 2441 True 4337 4337 98.732 1 2440 1 chr7D.!!$R1 2439
6 TraesCS7A01G164500 chr1A 498689625 498692064 2439 False 4340 4340 98.772 1 2440 1 chr1A.!!$F1 2439
7 TraesCS7A01G164500 chr7B 716877179 716879620 2441 False 4337 4337 98.732 1 2440 1 chr7B.!!$F1 2439
8 TraesCS7A01G164500 chr7B 742988603 742991047 2444 True 4311 4311 98.528 1 2440 1 chr7B.!!$R1 2439
9 TraesCS7A01G164500 chr2B 112840195 112842637 2442 True 4265 4265 98.200 1 2439 1 chr2B.!!$R1 2438

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
60 61 2.676121 CATGGCAACCTTCCGGCA 60.676 61.111 0.0 0.0 42.39 5.69 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1789 1801 1.619654 AGGATCCATCTGCTCTCTCG 58.38 55.0 15.82 0.0 0.0 4.04 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
60 61 2.676121 CATGGCAACCTTCCGGCA 60.676 61.111 0.00 0.0 42.39 5.69
229 230 4.593206 AGGTCATAGCCGAAATAGGATTCA 59.407 41.667 0.00 0.0 0.00 2.57
244 245 3.118261 AGGATTCATTTTGGCTAGAGCGA 60.118 43.478 0.00 0.0 43.26 4.93
408 409 9.485206 GTACGAATATAACCTACATGTCCAATT 57.515 33.333 0.00 0.0 0.00 2.32
798 799 3.409026 AAAGTGCTCTCTGAACCGAAT 57.591 42.857 0.00 0.0 0.00 3.34
1219 1220 4.660303 AGGGATATGCACCTTATCTGAACA 59.340 41.667 5.92 0.0 31.68 3.18
1476 1479 1.282157 AGGGGAAGATTAGCAAAGCGT 59.718 47.619 0.00 0.0 0.00 5.07
1789 1801 6.674694 TGCATCAAAGAAAATAGAGAGAGC 57.325 37.500 0.00 0.0 0.00 4.09
2044 2062 3.728385 ATAGGCAGGCTTCTTTCAGTT 57.272 42.857 0.00 0.0 0.00 3.16
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
60 61 0.179092 GCGTTATAGGTCGTTGGGCT 60.179 55.000 0.00 0.0 0.00 5.19
229 230 2.489938 TTGGTCGCTCTAGCCAAAAT 57.510 45.000 0.00 0.0 39.09 1.82
244 245 6.147164 CGTGTCAAATATATAGCGGATTTGGT 59.853 38.462 7.65 0.0 39.79 3.67
408 409 6.437477 TCAAAAGACCTCTAGCTCATAGTTCA 59.563 38.462 0.00 0.0 32.85 3.18
682 683 1.500474 TCAATCTCTCGAGCCCCAAT 58.500 50.000 7.81 0.0 0.00 3.16
798 799 5.448496 CGTCTGATGGAAAACAACTTTCACA 60.448 40.000 0.16 0.0 44.61 3.58
1256 1257 3.788227 TGTTTGAGCCTATGTTCACCT 57.212 42.857 0.00 0.0 30.81 4.00
1476 1479 2.157911 TCCCCCTCCCTCTGTCTTTTTA 60.158 50.000 0.00 0.0 0.00 1.52
1789 1801 1.619654 AGGATCCATCTGCTCTCTCG 58.380 55.000 15.82 0.0 0.00 4.04
2044 2062 5.167121 CCGGTGAAAATGAATATGTTTGCA 58.833 37.500 0.00 0.0 0.00 4.08


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.