Multiple sequence alignment - TraesCS7A01G164400

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS7A01G164400 chr7A 100.000 2258 0 0 1 2258 120841193 120838936 0.000000e+00 4170.0
1 TraesCS7A01G164400 chr7A 98.760 2258 28 0 1 2258 60279280 60281537 0.000000e+00 4015.0
2 TraesCS7A01G164400 chr7A 100.000 47 0 0 2548 2594 120838646 120838600 1.280000e-13 87.9
3 TraesCS7A01G164400 chr5A 99.159 2259 18 1 1 2258 19248877 19246619 0.000000e+00 4065.0
4 TraesCS7A01G164400 chr7D 99.070 2258 21 0 1 2258 203499966 203502223 0.000000e+00 4054.0
5 TraesCS7A01G164400 chr7D 99.070 2258 21 0 1 2258 381923968 381926225 0.000000e+00 4054.0
6 TraesCS7A01G164400 chr7D 98.982 2259 22 1 1 2258 382050045 382052303 0.000000e+00 4043.0
7 TraesCS7A01G164400 chr7D 98.981 2258 20 1 1 2258 381973800 381971546 0.000000e+00 4039.0
8 TraesCS7A01G164400 chr6D 98.937 2258 24 0 1 2258 124517489 124519746 0.000000e+00 4037.0
9 TraesCS7A01G164400 chr6D 100.000 44 0 0 2548 2591 124519799 124519842 5.950000e-12 82.4
10 TraesCS7A01G164400 chr6D 100.000 44 0 0 2548 2591 168757375 168757418 5.950000e-12 82.4
11 TraesCS7A01G164400 chr6D 100.000 44 0 0 2548 2591 168758167 168758210 5.950000e-12 82.4
12 TraesCS7A01G164400 chr6D 100.000 44 0 0 2548 2591 458900459 458900502 5.950000e-12 82.4
13 TraesCS7A01G164400 chr7B 98.937 2258 23 1 1 2258 716878813 716876557 0.000000e+00 4036.0
14 TraesCS7A01G164400 chr1A 98.893 2258 25 0 1 2258 498691260 498689003 0.000000e+00 4032.0
15 TraesCS7A01G164400 chr5B 100.000 47 0 0 2548 2594 701110375 701110329 1.280000e-13 87.9
16 TraesCS7A01G164400 chrUn 97.872 47 1 0 2548 2594 186206144 186206098 5.950000e-12 82.4
17 TraesCS7A01G164400 chrUn 100.000 44 0 0 2548 2591 434805852 434805895 5.950000e-12 82.4
18 TraesCS7A01G164400 chr4D 100.000 44 0 0 2548 2591 123337748 123337791 5.950000e-12 82.4
19 TraesCS7A01G164400 chr4D 100.000 44 0 0 2548 2591 123552207 123552250 5.950000e-12 82.4


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS7A01G164400 chr7A 120838600 120841193 2593 True 2128.95 4170 100.0000 1 2594 2 chr7A.!!$R1 2593
1 TraesCS7A01G164400 chr7A 60279280 60281537 2257 False 4015.00 4015 98.7600 1 2258 1 chr7A.!!$F1 2257
2 TraesCS7A01G164400 chr5A 19246619 19248877 2258 True 4065.00 4065 99.1590 1 2258 1 chr5A.!!$R1 2257
3 TraesCS7A01G164400 chr7D 203499966 203502223 2257 False 4054.00 4054 99.0700 1 2258 1 chr7D.!!$F1 2257
4 TraesCS7A01G164400 chr7D 381923968 381926225 2257 False 4054.00 4054 99.0700 1 2258 1 chr7D.!!$F2 2257
5 TraesCS7A01G164400 chr7D 382050045 382052303 2258 False 4043.00 4043 98.9820 1 2258 1 chr7D.!!$F3 2257
6 TraesCS7A01G164400 chr7D 381971546 381973800 2254 True 4039.00 4039 98.9810 1 2258 1 chr7D.!!$R1 2257
7 TraesCS7A01G164400 chr6D 124517489 124519842 2353 False 2059.70 4037 99.4685 1 2591 2 chr6D.!!$F2 2590
8 TraesCS7A01G164400 chr7B 716876557 716878813 2256 True 4036.00 4036 98.9370 1 2258 1 chr7B.!!$R1 2257
9 TraesCS7A01G164400 chr1A 498689003 498691260 2257 True 4032.00 4032 98.8930 1 2258 1 chr1A.!!$R1 2257

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
953 955 1.500474 TCAATCTCTCGAGCCCCAAT 58.5 50.0 7.81 0.0 0.0 3.16 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2013 2015 5.825151 CCTCTTATTTCTTCATTGGAGGGTC 59.175 44.0 0.0 0.0 36.44 4.46 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
159 160 2.157911 TCCCCCTCCCTCTGTCTTTTTA 60.158 50.000 0.00 0.0 0.00 1.52
379 381 3.788227 TGTTTGAGCCTATGTTCACCT 57.212 42.857 0.00 0.0 30.81 4.00
837 839 5.448496 CGTCTGATGGAAAACAACTTTCACA 60.448 40.000 0.16 0.0 44.61 3.58
953 955 1.500474 TCAATCTCTCGAGCCCCAAT 58.500 50.000 7.81 0.0 0.00 3.16
1227 1229 6.437477 TCAAAAGACCTCTAGCTCATAGTTCA 59.563 38.462 0.00 0.0 32.85 3.18
1391 1393 6.147164 CGTGTCAAATATATAGCGGATTTGGT 59.853 38.462 7.65 0.0 39.79 3.67
1406 1408 2.489938 TTGGTCGCTCTAGCCAAAAT 57.510 45.000 0.00 0.0 39.09 1.82
1575 1577 0.179092 GCGTTATAGGTCGTTGGGCT 60.179 55.000 0.00 0.0 0.00 5.19
2013 2015 3.659089 AACGGCGAAGTCCATCCGG 62.659 63.158 16.62 0.0 45.58 5.14
2046 2048 7.622893 ATGAAGAAATAAGAGGAGAGCAAAC 57.377 36.000 0.00 0.0 0.00 2.93
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
159 160 1.282157 AGGGGAAGATTAGCAAAGCGT 59.718 47.619 0.00 0.0 0.00 5.07
416 418 4.660303 AGGGATATGCACCTTATCTGAACA 59.340 41.667 5.92 0.0 31.68 3.18
837 839 3.409026 AAAGTGCTCTCTGAACCGAAT 57.591 42.857 0.00 0.0 0.00 3.34
1227 1229 9.485206 GTACGAATATAACCTACATGTCCAATT 57.515 33.333 0.00 0.0 0.00 2.32
1391 1393 3.118261 AGGATTCATTTTGGCTAGAGCGA 60.118 43.478 0.00 0.0 43.26 4.93
1406 1408 4.593206 AGGTCATAGCCGAAATAGGATTCA 59.407 41.667 0.00 0.0 0.00 2.57
1575 1577 2.676121 CATGGCAACCTTCCGGCA 60.676 61.111 0.00 0.0 42.39 5.69
2013 2015 5.825151 CCTCTTATTTCTTCATTGGAGGGTC 59.175 44.000 0.00 0.0 36.44 4.46


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.