Multiple sequence alignment - TraesCS7A01G164300

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS7A01G164300 chr7A 100.000 1470 0 0 1481 2950 120838936 120840405 0 2715
1 TraesCS7A01G164300 chr7A 100.000 1191 0 0 1 1191 120837456 120838646 0 2200
2 TraesCS7A01G164300 chr7A 98.826 1192 13 1 1 1191 60282781 60281590 0 2122
3 TraesCS7A01G164300 chr5A 99.048 1470 14 0 1481 2950 19246619 19248088 0 2638
4 TraesCS7A01G164300 chr5A 98.497 1198 11 2 1 1191 19245369 19246566 0 2106
5 TraesCS7A01G164300 chr7D 98.980 1470 15 0 1481 2950 381926225 381924756 0 2632
6 TraesCS7A01G164300 chr7D 98.912 1470 16 0 1481 2950 382052303 382050834 0 2627
7 TraesCS7A01G164300 chr7D 98.844 1470 17 0 1481 2950 203502223 203500754 0 2621
8 TraesCS7A01G164300 chr7D 98.776 1470 15 1 1481 2950 381971546 381973012 0 2612
9 TraesCS7A01G164300 chr7D 98.579 1196 12 1 1 1191 382053551 382052356 0 2109
10 TraesCS7A01G164300 chr7B 98.912 1470 16 0 1481 2950 716876557 716878026 0 2627
11 TraesCS7A01G164300 chr7B 98.639 1470 20 0 1481 2950 716836346 716837815 0 2604
12 TraesCS7A01G164300 chr7B 98.574 1192 15 1 1 1190 716875312 716876503 0 2106
13 TraesCS7A01G164300 chr7B 98.574 1192 16 1 1 1191 742992914 742991723 0 2106
14 TraesCS7A01G164300 chr1A 98.844 1470 17 0 1481 2950 498689003 498690472 0 2621
15 TraesCS7A01G164300 chr1A 98.406 1192 18 1 1 1191 498687759 498688950 0 2095
16 TraesCS7A01G164300 chr6D 98.639 1470 20 0 1481 2950 124519746 124518277 0 2604
17 TraesCS7A01G164300 chrUn 98.826 1193 12 1 1 1191 186204952 186206144 0 2124
18 TraesCS7A01G164300 chr2B 98.407 1193 17 2 1 1191 112844671 112843479 0 2097
19 TraesCS7A01G164300 chr2B 98.406 1192 18 1 1 1191 391164477 391163286 0 2095


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS7A01G164300 chr7A 120837456 120840405 2949 False 2457.5 2715 100.0000 1 2950 2 chr7A.!!$F1 2949
1 TraesCS7A01G164300 chr7A 60281590 60282781 1191 True 2122.0 2122 98.8260 1 1191 1 chr7A.!!$R1 1190
2 TraesCS7A01G164300 chr5A 19245369 19248088 2719 False 2372.0 2638 98.7725 1 2950 2 chr5A.!!$F1 2949
3 TraesCS7A01G164300 chr7D 381924756 381926225 1469 True 2632.0 2632 98.9800 1481 2950 1 chr7D.!!$R2 1469
4 TraesCS7A01G164300 chr7D 203500754 203502223 1469 True 2621.0 2621 98.8440 1481 2950 1 chr7D.!!$R1 1469
5 TraesCS7A01G164300 chr7D 381971546 381973012 1466 False 2612.0 2612 98.7760 1481 2950 1 chr7D.!!$F1 1469
6 TraesCS7A01G164300 chr7D 382050834 382053551 2717 True 2368.0 2627 98.7455 1 2950 2 chr7D.!!$R3 2949
7 TraesCS7A01G164300 chr7B 716836346 716837815 1469 False 2604.0 2604 98.6390 1481 2950 1 chr7B.!!$F1 1469
8 TraesCS7A01G164300 chr7B 716875312 716878026 2714 False 2366.5 2627 98.7430 1 2950 2 chr7B.!!$F2 2949
9 TraesCS7A01G164300 chr7B 742991723 742992914 1191 True 2106.0 2106 98.5740 1 1191 1 chr7B.!!$R1 1190
10 TraesCS7A01G164300 chr1A 498687759 498690472 2713 False 2358.0 2621 98.6250 1 2950 2 chr1A.!!$F1 2949
11 TraesCS7A01G164300 chr6D 124518277 124519746 1469 True 2604.0 2604 98.6390 1481 2950 1 chr6D.!!$R1 1469
12 TraesCS7A01G164300 chrUn 186204952 186206144 1192 False 2124.0 2124 98.8260 1 1191 1 chrUn.!!$F1 1190
13 TraesCS7A01G164300 chr2B 112843479 112844671 1192 True 2097.0 2097 98.4070 1 1191 1 chr2B.!!$R1 1190
14 TraesCS7A01G164300 chr2B 391163286 391164477 1191 True 2095.0 2095 98.4060 1 1191 1 chr2B.!!$R2 1190

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
144 145 3.008485 GGAAGGACAAAGGAGACAGACAT 59.992 47.826 0.0 0.0 0.0 3.06 F
1067 1072 0.691078 CTGGGCAGGGGTAAGCTCTA 60.691 60.000 0.0 0.0 0.0 2.43 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1724 1734 3.659089 AACGGCGAAGTCCATCCGG 62.659 63.158 16.62 0.0 45.58 5.14 R
2162 2172 0.179092 GCGTTATAGGTCGTTGGGCT 60.179 55.000 0.00 0.0 0.00 5.19 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
144 145 3.008485 GGAAGGACAAAGGAGACAGACAT 59.992 47.826 0.0 0.0 0.00 3.06
338 342 5.766150 ACCTTGTCAATGATCGAACAAAA 57.234 34.783 0.0 0.0 31.75 2.44
642 647 3.327757 TCACCAACTTCACTTGCCTCTAT 59.672 43.478 0.0 0.0 0.00 1.98
738 743 7.821359 TCAAGATGATTCTTTCTTTGTCGAGAT 59.179 33.333 0.0 0.0 40.28 2.75
1067 1072 0.691078 CTGGGCAGGGGTAAGCTCTA 60.691 60.000 0.0 0.0 0.00 2.43
1724 1734 5.825151 CCTCTTATTTCTTCATTGGAGGGTC 59.175 44.000 0.0 0.0 36.44 4.46
2162 2172 2.676121 CATGGCAACCTTCCGGCA 60.676 61.111 0.0 0.0 42.39 5.69
2331 2341 4.593206 AGGTCATAGCCGAAATAGGATTCA 59.407 41.667 0.0 0.0 0.00 2.57
2346 2356 3.118261 AGGATTCATTTTGGCTAGAGCGA 60.118 43.478 0.0 0.0 43.26 4.93
2510 2520 9.485206 GTACGAATATAACCTACATGTCCAATT 57.515 33.333 0.0 0.0 0.00 2.32
2900 2910 3.409026 AAAGTGCTCTCTGAACCGAAT 57.591 42.857 0.0 0.0 0.00 3.34
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
338 342 9.632638 AAATGGCACTTAGTTCATATCTGTAAT 57.367 29.630 0.00 0.0 0.00 1.89
354 358 5.295292 CGATCTTACTCATCAAATGGCACTT 59.705 40.000 0.00 0.0 0.00 3.16
738 743 4.890581 TCGAAAAGATGGGTTCCTTTTTCA 59.109 37.500 0.00 0.0 41.17 2.69
1052 1057 4.757149 CACATTTATAGAGCTTACCCCTGC 59.243 45.833 0.00 0.0 0.00 4.85
1067 1072 4.943705 CCACACTTGGCTCTACACATTTAT 59.056 41.667 0.00 0.0 35.56 1.40
1691 1701 7.622893 ATGAAGAAATAAGAGGAGAGCAAAC 57.377 36.000 0.00 0.0 0.00 2.93
1724 1734 3.659089 AACGGCGAAGTCCATCCGG 62.659 63.158 16.62 0.0 45.58 5.14
2162 2172 0.179092 GCGTTATAGGTCGTTGGGCT 60.179 55.000 0.00 0.0 0.00 5.19
2331 2341 2.489938 TTGGTCGCTCTAGCCAAAAT 57.510 45.000 0.00 0.0 39.09 1.82
2346 2356 6.147164 CGTGTCAAATATATAGCGGATTTGGT 59.853 38.462 7.65 0.0 39.79 3.67
2510 2520 6.437477 TCAAAAGACCTCTAGCTCATAGTTCA 59.563 38.462 0.00 0.0 32.85 3.18
2784 2794 1.500474 TCAATCTCTCGAGCCCCAAT 58.500 50.000 7.81 0.0 0.00 3.16
2900 2910 5.448496 CGTCTGATGGAAAACAACTTTCACA 60.448 40.000 0.16 0.0 44.61 3.58


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.