Multiple sequence alignment - TraesCS7A01G159900

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS7A01G159900 chr7A 100.000 2531 0 0 1 2531 116057743 116055213 0.000000e+00 4674.0
1 TraesCS7A01G159900 chr7A 98.284 2098 35 1 434 2531 160993066 160990970 0.000000e+00 3674.0
2 TraesCS7A01G159900 chr7A 91.446 1847 144 11 692 2531 54862213 54860374 0.000000e+00 2523.0
3 TraesCS7A01G159900 chr7A 97.917 144 2 1 1 143 160993214 160993071 5.410000e-62 248.0
4 TraesCS7A01G159900 chr5A 98.579 2533 30 3 1 2531 638638309 638640837 0.000000e+00 4473.0
5 TraesCS7A01G159900 chr2A 94.915 2537 103 13 1 2531 533181026 533178510 0.000000e+00 3947.0
6 TraesCS7A01G159900 chr5B 91.680 1851 136 13 692 2531 523901449 523899606 0.000000e+00 2549.0
7 TraesCS7A01G159900 chr5B 83.730 252 36 2 308 555 703769820 703769570 1.510000e-57 233.0
8 TraesCS7A01G159900 chr5B 94.340 53 3 0 579 631 703769192 703769140 5.800000e-12 82.4
9 TraesCS7A01G159900 chr6A 91.333 1846 146 11 692 2531 577050676 577048839 0.000000e+00 2510.0
10 TraesCS7A01G159900 chr6A 90.659 1381 121 8 692 2071 46445426 46446799 0.000000e+00 1829.0
11 TraesCS7A01G159900 chr6A 84.674 261 35 2 299 555 20722325 20722584 3.230000e-64 255.0
12 TraesCS7A01G159900 chr1B 95.670 1201 31 7 781 1980 18657455 18656275 0.000000e+00 1910.0
13 TraesCS7A01G159900 chr1B 93.689 919 37 9 4 920 18658354 18657455 0.000000e+00 1356.0
14 TraesCS7A01G159900 chrUn 90.642 748 60 6 1794 2531 11852087 11852834 0.000000e+00 985.0
15 TraesCS7A01G159900 chrUn 90.508 748 61 6 1794 2531 318613204 318613951 0.000000e+00 979.0
16 TraesCS7A01G159900 chrUn 90.508 748 61 7 1794 2531 385585134 385585881 0.000000e+00 979.0
17 TraesCS7A01G159900 chrUn 91.982 449 35 1 1351 1799 11851485 11851932 1.650000e-176 628.0
18 TraesCS7A01G159900 chrUn 92.640 394 25 3 692 1085 11851072 11851461 4.730000e-157 564.0
19 TraesCS7A01G159900 chrUn 92.640 394 25 3 692 1085 318612189 318612578 4.730000e-157 564.0
20 TraesCS7A01G159900 chr7B 84.518 394 46 11 1071 1453 107099346 107099735 2.380000e-100 375.0
21 TraesCS7A01G159900 chr1A 85.441 261 33 2 299 555 517450068 517449809 1.490000e-67 267.0
22 TraesCS7A01G159900 chr1A 92.453 53 4 0 579 631 517449423 517449371 2.700000e-10 76.8
23 TraesCS7A01G159900 chr4B 84.109 258 36 2 302 555 309438540 309438284 6.990000e-61 244.0
24 TraesCS7A01G159900 chr4B 81.992 261 42 2 299 555 328587844 328588103 1.520000e-52 217.0
25 TraesCS7A01G159900 chr4B 94.340 53 3 0 579 631 309437899 309437847 5.800000e-12 82.4
26 TraesCS7A01G159900 chr4B 93.750 48 3 0 584 631 328588484 328588531 3.490000e-09 73.1
27 TraesCS7A01G159900 chr2B 83.525 261 36 3 299 555 27498519 27498776 1.170000e-58 237.0
28 TraesCS7A01G159900 chr2B 84.848 165 18 5 1 164 2710371 2710529 2.610000e-35 159.0
29 TraesCS7A01G159900 chr3B 85.366 164 19 3 1 164 108285482 108285640 5.600000e-37 165.0
30 TraesCS7A01G159900 chr3A 97.368 38 1 0 579 616 560755323 560755360 5.840000e-07 65.8


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS7A01G159900 chr7A 116055213 116057743 2530 True 4674.000000 4674 100.000000 1 2531 1 chr7A.!!$R2 2530
1 TraesCS7A01G159900 chr7A 54860374 54862213 1839 True 2523.000000 2523 91.446000 692 2531 1 chr7A.!!$R1 1839
2 TraesCS7A01G159900 chr7A 160990970 160993214 2244 True 1961.000000 3674 98.100500 1 2531 2 chr7A.!!$R3 2530
3 TraesCS7A01G159900 chr5A 638638309 638640837 2528 False 4473.000000 4473 98.579000 1 2531 1 chr5A.!!$F1 2530
4 TraesCS7A01G159900 chr2A 533178510 533181026 2516 True 3947.000000 3947 94.915000 1 2531 1 chr2A.!!$R1 2530
5 TraesCS7A01G159900 chr5B 523899606 523901449 1843 True 2549.000000 2549 91.680000 692 2531 1 chr5B.!!$R1 1839
6 TraesCS7A01G159900 chr6A 577048839 577050676 1837 True 2510.000000 2510 91.333000 692 2531 1 chr6A.!!$R1 1839
7 TraesCS7A01G159900 chr6A 46445426 46446799 1373 False 1829.000000 1829 90.659000 692 2071 1 chr6A.!!$F2 1379
8 TraesCS7A01G159900 chr1B 18656275 18658354 2079 True 1633.000000 1910 94.679500 4 1980 2 chr1B.!!$R1 1976
9 TraesCS7A01G159900 chrUn 385585134 385585881 747 False 979.000000 979 90.508000 1794 2531 1 chrUn.!!$F1 737
10 TraesCS7A01G159900 chrUn 318612189 318613951 1762 False 771.500000 979 91.574000 692 2531 2 chrUn.!!$F3 1839
11 TraesCS7A01G159900 chrUn 11851072 11852834 1762 False 725.666667 985 91.754667 692 2531 3 chrUn.!!$F2 1839

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
429 432 0.330267 CGGGTTGGGGTTATTCCAGT 59.67 55.0 0.0 0.0 38.11 4.0 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2392 2714 1.212935 GTCTGTTGGGGCTATCATGGT 59.787 52.381 0.0 0.0 0.0 3.55 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
55 56 2.348411 ACCTCTTGTGACCCAACTTG 57.652 50.000 0.00 0.0 0.00 3.16
425 428 1.755395 GGGCGGGTTGGGGTTATTC 60.755 63.158 0.00 0.0 0.00 1.75
429 432 0.330267 CGGGTTGGGGTTATTCCAGT 59.670 55.000 0.00 0.0 38.11 4.00
640 643 6.978338 TCGAGACTTGTTTAATCACTACACT 58.022 36.000 0.00 0.0 0.00 3.55
700 703 4.263209 CGAGACATTATAATCGACATCGGC 59.737 45.833 0.73 0.0 40.29 5.54
1344 1493 9.400638 GTGAAGTAACGATAGAAGGAGATATTG 57.599 37.037 0.00 0.0 41.38 1.90
1664 1816 2.424379 GGGAAACACAAAAGAGGGGAGT 60.424 50.000 0.00 0.0 0.00 3.85
2302 2623 4.088056 TGTTGGTCGGGAAAGAATACAA 57.912 40.909 0.00 0.0 0.00 2.41
2392 2714 1.108776 CATAGTCGGTCGGGAAAGGA 58.891 55.000 0.00 0.0 0.00 3.36
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
640 643 3.522759 TGGTAGGGAAATCTGGTGTGTA 58.477 45.455 0.0 0.0 0.0 2.90
700 703 4.746729 CCAAGTGAGAGAGTGAGATCTTG 58.253 47.826 0.0 0.0 0.0 3.02
816 821 8.529424 TTCTCTATTTCCATGAATCAAAGCAT 57.471 30.769 0.0 0.0 0.0 3.79
1344 1493 6.144402 CCACTTGCTATCACAAACAACAATTC 59.856 38.462 0.0 0.0 0.0 2.17
1643 1795 2.239400 CTCCCCTCTTTTGTGTTTCCC 58.761 52.381 0.0 0.0 0.0 3.97
1708 1860 9.806203 TTCAATATCATTTCATACCAAAGCAAG 57.194 29.630 0.0 0.0 0.0 4.01
2302 2623 3.924114 TCCCAACCGACAATATGACAT 57.076 42.857 0.0 0.0 0.0 3.06
2392 2714 1.212935 GTCTGTTGGGGCTATCATGGT 59.787 52.381 0.0 0.0 0.0 3.55


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.