Multiple sequence alignment - TraesCS7A01G143400

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS7A01G143400 chr7A 100.000 2323 0 0 1 2323 94445668 94443346 0 4290
1 TraesCS7A01G143400 chr7A 97.425 2291 53 3 34 2323 665977683 665979968 0 3899
2 TraesCS7A01G143400 chr5A 97.805 2323 48 1 1 2323 30143743 30146062 0 4004
3 TraesCS7A01G143400 chr2A 97.555 2290 54 1 34 2323 690342196 690344483 0 3917
4 TraesCS7A01G143400 chr3A 97.116 2323 63 2 1 2323 740090420 740088102 0 3916
5 TraesCS7A01G143400 chr3A 97.424 2290 57 1 34 2323 60827737 60825450 0 3901
6 TraesCS7A01G143400 chr2D 96.738 2330 66 3 1 2323 63681704 63684030 0 3873
7 TraesCS7A01G143400 chr5D 95.928 2333 80 7 1 2323 60521632 60519305 0 3768
8 TraesCS7A01G143400 chr1A 95.531 2327 94 4 1 2323 72584820 72587140 0 3712
9 TraesCS7A01G143400 chr4D 96.665 2219 64 3 112 2323 496006351 496008566 0 3679
10 TraesCS7A01G143400 chr1B 94.596 2313 113 9 1 2305 122762315 122764623 0 3568


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS7A01G143400 chr7A 94443346 94445668 2322 True 4290 4290 100.000 1 2323 1 chr7A.!!$R1 2322
1 TraesCS7A01G143400 chr7A 665977683 665979968 2285 False 3899 3899 97.425 34 2323 1 chr7A.!!$F1 2289
2 TraesCS7A01G143400 chr5A 30143743 30146062 2319 False 4004 4004 97.805 1 2323 1 chr5A.!!$F1 2322
3 TraesCS7A01G143400 chr2A 690342196 690344483 2287 False 3917 3917 97.555 34 2323 1 chr2A.!!$F1 2289
4 TraesCS7A01G143400 chr3A 740088102 740090420 2318 True 3916 3916 97.116 1 2323 1 chr3A.!!$R2 2322
5 TraesCS7A01G143400 chr3A 60825450 60827737 2287 True 3901 3901 97.424 34 2323 1 chr3A.!!$R1 2289
6 TraesCS7A01G143400 chr2D 63681704 63684030 2326 False 3873 3873 96.738 1 2323 1 chr2D.!!$F1 2322
7 TraesCS7A01G143400 chr5D 60519305 60521632 2327 True 3768 3768 95.928 1 2323 1 chr5D.!!$R1 2322
8 TraesCS7A01G143400 chr1A 72584820 72587140 2320 False 3712 3712 95.531 1 2323 1 chr1A.!!$F1 2322
9 TraesCS7A01G143400 chr4D 496006351 496008566 2215 False 3679 3679 96.665 112 2323 1 chr4D.!!$F1 2211
10 TraesCS7A01G143400 chr1B 122762315 122764623 2308 False 3568 3568 94.596 1 2305 1 chr1B.!!$F1 2304

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
770 783 0.743345 GGTACGCCAGGGCTTACTTG 60.743 60.0 21.61 3.47 42.87 3.16 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2187 2214 1.542915 AGTAAAGCGGCTAGTGTTCGA 59.457 47.619 1.35 0.0 0.0 3.71 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
90 95 5.050363 ACGATTTTGTATATGATGCGGTCAC 60.050 40.000 0.00 0.00 40.28 3.67
160 165 5.940470 GGATGTTTGAGCCGGATAAATATCT 59.060 40.000 22.10 4.91 34.43 1.98
216 224 2.024176 TGTGCTAGTGGAAAGAGGGA 57.976 50.000 0.00 0.00 0.00 4.20
365 377 1.977056 TGAGGTATGACCGTCGCTAT 58.023 50.000 0.00 0.00 44.90 2.97
482 495 3.362262 CGTTGGAGACCGGAGACA 58.638 61.111 9.46 0.00 0.00 3.41
541 554 4.130118 ACTTTGGAGGATATTGCGATGAC 58.870 43.478 0.00 0.00 0.00 3.06
770 783 0.743345 GGTACGCCAGGGCTTACTTG 60.743 60.000 21.61 3.47 42.87 3.16
1050 1065 1.763545 GGTTTTGTTTGGGCCCTACAA 59.236 47.619 28.45 28.45 0.00 2.41
1284 1299 4.736611 ATCCCTTGCCATCATTACAGAT 57.263 40.909 0.00 0.00 0.00 2.90
1285 1300 4.524802 TCCCTTGCCATCATTACAGATT 57.475 40.909 0.00 0.00 0.00 2.40
1404 1420 2.874014 TCATGACCAACATCTTTGGCA 58.126 42.857 2.85 3.32 43.23 4.92
1799 1816 6.262207 AGTACAGAGTTATCCTTAAGGGTGT 58.738 40.000 21.53 9.77 36.25 4.16
1913 1930 1.075050 AGATTATGGCCCTCTGCATGG 59.925 52.381 0.00 0.00 43.89 3.66
2187 2214 2.290641 GCAGAAGGTTGTGAATCGTTGT 59.709 45.455 0.00 0.00 0.00 3.32
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
160 165 4.556233 CTCGTAATAATCATCAAGGCCGA 58.444 43.478 0.00 0.0 0.00 5.54
287 299 6.388619 ACTGGAGGAACCTACAAATAACAT 57.611 37.500 7.22 0.0 36.31 2.71
365 377 8.497745 AGATCCATTCTTCTAAAATAAGGCTCA 58.502 33.333 0.00 0.0 0.00 4.26
482 495 3.567478 AGAGCAAGGTGAAAAGAGTGT 57.433 42.857 0.00 0.0 0.00 3.55
770 783 3.005791 CCACTTGGGTCAAAAGATTCCAC 59.994 47.826 0.00 0.0 0.00 4.02
799 812 3.228017 TGTCTCCCGTGCCGTCAA 61.228 61.111 0.00 0.0 0.00 3.18
1050 1065 2.799126 TACGCTCCCACATCCAAATT 57.201 45.000 0.00 0.0 0.00 1.82
1469 1486 4.356289 GTGCGTTGTTGTACTCCAAATTT 58.644 39.130 0.00 0.0 34.07 1.82
1913 1930 2.292292 ACAAAAAGACATACCACACGGC 59.708 45.455 0.00 0.0 34.57 5.68
1917 1934 7.639113 AAAAGAGACAAAAAGACATACCACA 57.361 32.000 0.00 0.0 0.00 4.17
2187 2214 1.542915 AGTAAAGCGGCTAGTGTTCGA 59.457 47.619 1.35 0.0 0.00 3.71


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.