Multiple sequence alignment - TraesCS7A01G135100

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS7A01G135100 chr7A 100.000 4264 0 0 1 4264 88014874 88010611 0 7875
1 TraesCS7A01G135100 chr7A 97.443 4263 84 9 1 4262 88128131 88123893 0 7245
2 TraesCS7A01G135100 chr7A 96.696 4268 93 8 1 4264 88178882 88174659 0 7057
3 TraesCS7A01G135100 chr7A 92.467 4301 246 28 3 4264 88442383 88438122 0 6076
4 TraesCS7A01G135100 chr7A 91.431 2649 173 16 3 2635 88324181 88321571 0 3585
5 TraesCS7A01G135100 chr7A 93.910 1445 74 10 2645 4078 88320596 88319155 0 2169
6 TraesCS7A01G135100 chr7D 93.352 4302 212 29 3 4264 87212952 87208685 0 6292
7 TraesCS7A01G135100 chr7D 94.031 4071 201 15 1 4053 86769007 86764961 0 6133
8 TraesCS7A01G135100 chr7D 94.031 3753 189 20 536 4264 86924514 86920773 0 5657
9 TraesCS7A01G135100 chr7D 90.068 3826 300 38 474 4264 86800998 86797218 0 4887
10 TraesCS7A01G135100 chr7D 93.874 2514 118 17 1 2510 86927778 86925297 0 3757
11 TraesCS7A01G135100 chr7D 87.446 2302 241 26 174 2445 86298641 86296358 0 2606
12 TraesCS7A01G135100 chr7B 90.634 3993 275 41 331 4264 35313768 35309816 0 5210
13 TraesCS7A01G135100 chr7B 90.963 3386 216 34 1 3356 35513768 35510443 0 4475


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS7A01G135100 chr7A 88010611 88014874 4263 True 7875 7875 100.0000 1 4264 1 chr7A.!!$R1 4263
1 TraesCS7A01G135100 chr7A 88123893 88128131 4238 True 7245 7245 97.4430 1 4262 1 chr7A.!!$R2 4261
2 TraesCS7A01G135100 chr7A 88174659 88178882 4223 True 7057 7057 96.6960 1 4264 1 chr7A.!!$R3 4263
3 TraesCS7A01G135100 chr7A 88438122 88442383 4261 True 6076 6076 92.4670 3 4264 1 chr7A.!!$R4 4261
4 TraesCS7A01G135100 chr7A 88319155 88324181 5026 True 2877 3585 92.6705 3 4078 2 chr7A.!!$R5 4075
5 TraesCS7A01G135100 chr7D 87208685 87212952 4267 True 6292 6292 93.3520 3 4264 1 chr7D.!!$R4 4261
6 TraesCS7A01G135100 chr7D 86764961 86769007 4046 True 6133 6133 94.0310 1 4053 1 chr7D.!!$R2 4052
7 TraesCS7A01G135100 chr7D 86797218 86800998 3780 True 4887 4887 90.0680 474 4264 1 chr7D.!!$R3 3790
8 TraesCS7A01G135100 chr7D 86920773 86927778 7005 True 4707 5657 93.9525 1 4264 2 chr7D.!!$R5 4263
9 TraesCS7A01G135100 chr7D 86296358 86298641 2283 True 2606 2606 87.4460 174 2445 1 chr7D.!!$R1 2271
10 TraesCS7A01G135100 chr7B 35309816 35313768 3952 True 5210 5210 90.6340 331 4264 1 chr7B.!!$R1 3933
11 TraesCS7A01G135100 chr7B 35510443 35513768 3325 True 4475 4475 90.9630 1 3356 1 chr7B.!!$R2 3355

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
752 799 1.532868 CAATACTCAATAGGCCTGCGC 59.467 52.381 17.99 0.0 0.00 6.09 F
1322 4127 0.304705 CTCGCCGTGGAAATGCATAC 59.695 55.000 0.00 0.0 0.00 2.39 F
2098 4956 2.949644 AGTTTTGGACCAAAGAGGAACG 59.050 45.455 18.78 0.0 41.22 3.95 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1570 4385 2.267006 CATCAGCGGTGCCTCACT 59.733 61.111 10.38 0.0 34.4 3.41 R
2985 6850 3.081804 GGAGCCTGCAACTTAAAGCTTA 58.918 45.455 0.00 0.0 0.0 3.09 R
3748 7626 1.573829 CCGCAACGTAGCAACACCAT 61.574 55.000 0.00 0.0 0.0 3.55 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
202 204 5.734855 ATCACGTAGAAATCCCGAAATTG 57.265 39.130 0.00 0.0 0.00 2.32
209 216 6.523201 CGTAGAAATCCCGAAATTGTTTTGAG 59.477 38.462 0.00 0.0 0.00 3.02
210 217 6.648879 AGAAATCCCGAAATTGTTTTGAGA 57.351 33.333 0.00 0.0 0.00 3.27
211 218 6.681777 AGAAATCCCGAAATTGTTTTGAGAG 58.318 36.000 0.00 0.0 0.00 3.20
212 219 6.490040 AGAAATCCCGAAATTGTTTTGAGAGA 59.510 34.615 0.00 0.0 0.00 3.10
253 268 7.993416 AGAGAGAGAGAGAGATGGAAGATAAT 58.007 38.462 0.00 0.0 0.00 1.28
752 799 1.532868 CAATACTCAATAGGCCTGCGC 59.467 52.381 17.99 0.0 0.00 6.09
790 841 4.336889 TCTTGAGTATATTTGGAGGCCG 57.663 45.455 0.00 0.0 0.00 6.13
1048 3850 3.648545 GTCTCCATCCCCAAGCTATAACT 59.351 47.826 0.00 0.0 0.00 2.24
1172 3977 2.158652 AGGCATGCTCACTCATTGCTAT 60.159 45.455 18.92 0.0 0.00 2.97
1322 4127 0.304705 CTCGCCGTGGAAATGCATAC 59.695 55.000 0.00 0.0 0.00 2.39
2098 4956 2.949644 AGTTTTGGACCAAAGAGGAACG 59.050 45.455 18.78 0.0 41.22 3.95
2603 5503 4.562082 AGTAAGCATGCGTTGTTGTAGTA 58.438 39.130 12.39 0.0 0.00 1.82
2985 6850 1.002134 CCGGCCTCAACAATGACCT 60.002 57.895 0.00 0.0 0.00 3.85
3100 6965 0.111061 AGCCAATGTGGAGTGAGCAA 59.889 50.000 0.00 0.0 40.96 3.91
3538 7413 7.672983 ATCATAATTTGCCTACATTACGAGG 57.327 36.000 0.00 0.0 35.78 4.63
3997 7893 0.465705 GAGATCAGGGGCACGATTGA 59.534 55.000 0.00 0.0 0.00 2.57
4250 8150 2.364324 TGGACCGTTGGCTCATATCTAC 59.636 50.000 0.00 0.0 0.00 2.59
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
26 27 6.474427 GGCTTTTGCTTCGTAGTTTTAAACTT 59.526 34.615 15.83 0.81 46.54 2.66
194 196 5.928839 TCTCTCTCTCTCAAAACAATTTCGG 59.071 40.000 0.00 0.00 0.00 4.30
202 204 6.173339 TCTCTCTCTCTCTCTCTCTCAAAAC 58.827 44.000 0.00 0.00 0.00 2.43
209 216 5.136828 TCTCTCTCTCTCTCTCTCTCTCTC 58.863 50.000 0.00 0.00 0.00 3.20
210 217 5.103728 TCTCTCTCTCTCTCTCTCTCTCTCT 60.104 48.000 0.00 0.00 0.00 3.10
211 218 5.136828 TCTCTCTCTCTCTCTCTCTCTCTC 58.863 50.000 0.00 0.00 0.00 3.20
212 219 5.103728 TCTCTCTCTCTCTCTCTCTCTCTCT 60.104 48.000 0.00 0.00 0.00 3.10
565 603 4.265904 AGTGACACGTACATCAATGGAA 57.734 40.909 0.00 0.00 0.00 3.53
752 799 5.050091 ACTCAAGATTGCTAGAAACAACACG 60.050 40.000 0.00 0.00 0.00 4.49
1048 3850 8.718158 ATGAGGAGTATGAACTATGAAGATGA 57.282 34.615 0.00 0.00 35.56 2.92
1172 3977 4.141981 ACATGATTTTGTTGGTGTTGAGCA 60.142 37.500 0.00 0.00 0.00 4.26
1570 4385 2.267006 CATCAGCGGTGCCTCACT 59.733 61.111 10.38 0.00 34.40 3.41
2098 4956 9.344309 GAAGAATATAGGTATCGACTAACTTGC 57.656 37.037 0.00 0.00 0.00 4.01
2603 5503 3.551846 ACCAATTTGACAGGTTCGAACT 58.448 40.909 26.32 8.28 29.73 3.01
2985 6850 3.081804 GGAGCCTGCAACTTAAAGCTTA 58.918 45.455 0.00 0.00 0.00 3.09
3538 7413 4.929211 GCTTTTTCATGGGGTGATTACAAC 59.071 41.667 0.00 0.00 36.54 3.32
3748 7626 1.573829 CCGCAACGTAGCAACACCAT 61.574 55.000 0.00 0.00 0.00 3.55
3827 7723 8.638873 TGAACTATAGTGACGGTGAAATATGAT 58.361 33.333 6.06 0.00 0.00 2.45


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.