Multiple sequence alignment - TraesCS7A01G118300

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS7A01G118300 chr7A 100.000 5244 0 0 1 5244 76396818 76391575 0.000000e+00 9684.0
1 TraesCS7A01G118300 chr7A 99.485 5245 26 1 1 5244 76423514 76418270 0.000000e+00 9535.0
2 TraesCS7A01G118300 chr7A 96.710 4407 112 11 433 4836 76358847 76354471 0.000000e+00 7304.0
3 TraesCS7A01G118300 chr7A 98.203 3450 61 1 1796 5244 76455185 76451736 0.000000e+00 6026.0
4 TraesCS7A01G118300 chr7A 99.026 1027 7 1 1 1027 76479819 76478796 0.000000e+00 1838.0
5 TraesCS7A01G118300 chr7A 97.736 1016 13 4 1023 2038 76456188 76455183 0.000000e+00 1740.0
6 TraesCS7A01G118300 chr7A 84.170 1674 228 29 2983 4634 76292048 76290390 0.000000e+00 1589.0
7 TraesCS7A01G118300 chr7A 89.292 607 42 15 3 603 76364232 76363643 0.000000e+00 739.0
8 TraesCS7A01G118300 chr7A 90.647 417 15 4 4829 5244 76350617 76350224 2.780000e-147 532.0
9 TraesCS7A01G118300 chr7A 80.743 296 42 10 981 1268 76401690 76401402 3.180000e-52 217.0
10 TraesCS7A01G118300 chrUn 99.832 1788 3 0 481 2268 372177655 372179442 0.000000e+00 3286.0
11 TraesCS7A01G118300 chrUn 99.522 418 1 1 2696 3112 477052416 477051999 0.000000e+00 760.0
12 TraesCS7A01G118300 chrUn 100.000 306 0 0 4939 5244 479303589 479303284 2.740000e-157 566.0
13 TraesCS7A01G118300 chr7B 89.749 2312 181 29 2545 4834 12365157 12362880 0.000000e+00 2905.0
14 TraesCS7A01G118300 chr7B 86.838 2173 256 23 2696 4849 12212425 12210264 0.000000e+00 2401.0
15 TraesCS7A01G118300 chr7B 86.569 2189 192 51 320 2477 12367269 12365152 0.000000e+00 2320.0
16 TraesCS7A01G118300 chr7B 82.932 1535 135 66 303 1764 12209041 12207561 0.000000e+00 1266.0
17 TraesCS7A01G118300 chr7B 89.252 642 69 0 1809 2450 12244347 12243706 0.000000e+00 804.0
18 TraesCS7A01G118300 chr7B 88.802 643 70 2 1809 2450 12213068 12212427 0.000000e+00 787.0
19 TraesCS7A01G118300 chr7B 92.687 547 39 1 2908 3454 12362855 12362310 0.000000e+00 787.0
20 TraesCS7A01G118300 chr7B 86.233 523 52 15 1245 1764 12243196 12242691 2.760000e-152 549.0
21 TraesCS7A01G118300 chr7B 94.081 321 19 0 1 321 12378973 12378653 6.100000e-134 488.0
22 TraesCS7A01G118300 chr6A 88.235 2329 215 36 2468 4774 106736179 106738470 0.000000e+00 2728.0
23 TraesCS7A01G118300 chr6A 84.339 1143 146 21 1350 2476 106735033 106736158 0.000000e+00 1088.0
24 TraesCS7A01G118300 chr6A 90.289 381 27 8 4846 5224 106779629 106780001 1.700000e-134 490.0
25 TraesCS7A01G118300 chr6A 92.308 52 3 1 4771 4821 106743331 106743382 7.280000e-09 73.1
26 TraesCS7A01G118300 chr7D 88.295 2281 167 48 1 2249 69809047 69806835 0.000000e+00 2641.0
27 TraesCS7A01G118300 chr7D 87.029 2336 252 38 2545 4861 69782947 69780644 0.000000e+00 2588.0
28 TraesCS7A01G118300 chr7D 86.943 2336 254 38 2545 4861 69806642 69804339 0.000000e+00 2577.0
29 TraesCS7A01G118300 chr7D 84.207 1526 137 54 303 1764 69779752 69778267 0.000000e+00 1387.0
30 TraesCS7A01G118300 chr7D 84.207 1526 137 54 303 1764 69803470 69801985 0.000000e+00 1387.0
31 TraesCS7A01G118300 chr7D 84.777 1097 138 22 1361 2443 69712179 69711098 0.000000e+00 1074.0
32 TraesCS7A01G118300 chr7D 89.565 345 33 3 4859 5202 69714641 69714299 8.060000e-118 435.0
33 TraesCS7A01G118300 chr6D 83.333 102 15 2 2636 2736 140644661 140644561 5.590000e-15 93.5


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS7A01G118300 chr7A 76391575 76396818 5243 True 9684.000000 9684 100.000000 1 5244 1 chr7A.!!$R3 5243
1 TraesCS7A01G118300 chr7A 76418270 76423514 5244 True 9535.000000 9535 99.485000 1 5244 1 chr7A.!!$R5 5243
2 TraesCS7A01G118300 chr7A 76350224 76358847 8623 True 3918.000000 7304 93.678500 433 5244 2 chr7A.!!$R7 4811
3 TraesCS7A01G118300 chr7A 76451736 76456188 4452 True 3883.000000 6026 97.969500 1023 5244 2 chr7A.!!$R8 4221
4 TraesCS7A01G118300 chr7A 76478796 76479819 1023 True 1838.000000 1838 99.026000 1 1027 1 chr7A.!!$R6 1026
5 TraesCS7A01G118300 chr7A 76290390 76292048 1658 True 1589.000000 1589 84.170000 2983 4634 1 chr7A.!!$R1 1651
6 TraesCS7A01G118300 chr7A 76363643 76364232 589 True 739.000000 739 89.292000 3 603 1 chr7A.!!$R2 600
7 TraesCS7A01G118300 chrUn 372177655 372179442 1787 False 3286.000000 3286 99.832000 481 2268 1 chrUn.!!$F1 1787
8 TraesCS7A01G118300 chr7B 12362310 12367269 4959 True 2004.000000 2905 89.668333 320 4834 3 chr7B.!!$R4 4514
9 TraesCS7A01G118300 chr7B 12207561 12213068 5507 True 1484.666667 2401 86.190667 303 4849 3 chr7B.!!$R2 4546
10 TraesCS7A01G118300 chr7B 12242691 12244347 1656 True 676.500000 804 87.742500 1245 2450 2 chr7B.!!$R3 1205
11 TraesCS7A01G118300 chr6A 106735033 106738470 3437 False 1908.000000 2728 86.287000 1350 4774 2 chr6A.!!$F3 3424
12 TraesCS7A01G118300 chr7D 69801985 69809047 7062 True 2201.666667 2641 86.481667 1 4861 3 chr7D.!!$R3 4860
13 TraesCS7A01G118300 chr7D 69778267 69782947 4680 True 1987.500000 2588 85.618000 303 4861 2 chr7D.!!$R2 4558
14 TraesCS7A01G118300 chr7D 69711098 69714641 3543 True 754.500000 1074 87.171000 1361 5202 2 chr7D.!!$R1 3841

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
479 485 8.299262 ACATCTTTGAGTACATGCGATTATAC 57.701 34.615 0.00 0.00 0.00 1.47 F
1470 2645 0.613292 ATGCTCACCGAGTCTCAGGT 60.613 55.000 9.68 9.68 42.34 4.00 F
2955 4424 2.354704 CCTCGACAAGCACTTCCCATAA 60.355 50.000 0.00 0.00 0.00 1.90 F
3935 5430 1.418264 TCAACCTCCCGTCAATTGTCA 59.582 47.619 5.13 0.00 0.00 3.58 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1470 2645 4.627058 TCACTTACTTGCGATTGTCTCAA 58.373 39.13 0.00 0.0 0.00 3.02 R
2955 4424 2.357465 CCATGGTGGTGAGATTGATGGT 60.357 50.00 2.57 0.0 31.35 3.55 R
4152 5647 0.608130 TCCGTCTGACCATGTCAAGG 59.392 55.00 1.55 0.0 42.26 3.61 R
4757 6267 1.131303 AAAGGACATGGGTGGTCGGA 61.131 55.00 0.00 0.0 36.12 4.55 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
479 485 8.299262 ACATCTTTGAGTACATGCGATTATAC 57.701 34.615 0.00 0.00 0.00 1.47
1470 2645 0.613292 ATGCTCACCGAGTCTCAGGT 60.613 55.000 9.68 9.68 42.34 4.00
2955 4424 2.354704 CCTCGACAAGCACTTCCCATAA 60.355 50.000 0.00 0.00 0.00 1.90
3935 5430 1.418264 TCAACCTCCCGTCAATTGTCA 59.582 47.619 5.13 0.00 0.00 3.58
4152 5647 2.108970 AGGAGGATACACTTTCGGGAC 58.891 52.381 0.00 0.00 41.41 4.46
4176 5671 3.096852 TGACATGGTCAGACGGAAGTAT 58.903 45.455 0.00 0.00 40.59 2.12
4757 6267 2.629137 TGCAGTTGCTCATTCCATTGTT 59.371 40.909 5.62 0.00 42.66 2.83
4903 10288 1.228429 CACCACAATCACCCCCGTT 60.228 57.895 0.00 0.00 0.00 4.44
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
479 485 2.589798 TATAGACCCGCCAACTTTCG 57.410 50.000 0.00 0.0 0.00 3.46
1357 1375 5.009610 GTCAAGTAAAATGAGGGTGAGCAAA 59.990 40.000 0.00 0.0 0.00 3.68
1470 2645 4.627058 TCACTTACTTGCGATTGTCTCAA 58.373 39.130 0.00 0.0 0.00 3.02
2955 4424 2.357465 CCATGGTGGTGAGATTGATGGT 60.357 50.000 2.57 0.0 31.35 3.55
3338 4819 7.043391 GGCAACAATTGTCTCAAGTTAAGAAAC 60.043 37.037 12.39 0.0 32.08 2.78
3935 5430 2.670148 GGTCCTTGAGGTCCGGCAT 61.670 63.158 0.00 0.0 33.91 4.40
4152 5647 0.608130 TCCGTCTGACCATGTCAAGG 59.392 55.000 1.55 0.0 42.26 3.61
4176 5671 1.067142 CCGGAATTCGAACTGAGTGGA 60.067 52.381 0.00 0.0 42.43 4.02
4757 6267 1.131303 AAAGGACATGGGTGGTCGGA 61.131 55.000 0.00 0.0 36.12 4.55
4903 10288 3.481559 AATCAGAAGAGACCTCAGGGA 57.518 47.619 0.00 0.0 36.25 4.20


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.