Multiple sequence alignment - TraesCS7A01G113400

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS7A01G113400 chr7A 100.000 3005 0 0 1 3005 69567270 69570274 0.000000e+00 5550.0
1 TraesCS7A01G113400 chr7A 98.667 2476 31 2 532 3005 69618196 69620671 0.000000e+00 4388.0
2 TraesCS7A01G113400 chr7A 95.588 544 10 4 1 532 69617622 69618163 0.000000e+00 859.0
3 TraesCS7A01G113400 chr7A 97.015 67 1 1 2478 2544 69620054 69620119 8.810000e-21 111.0
4 TraesCS7A01G113400 chr7A 95.522 67 2 1 2478 2544 69569659 69569724 4.100000e-19 106.0
5 TraesCS7A01G113400 chr7A 95.522 67 2 1 2390 2455 69569747 69569813 4.100000e-19 106.0
6 TraesCS7A01G113400 chr7A 95.522 67 2 1 2390 2455 69620142 69620208 4.100000e-19 106.0
7 TraesCS7A01G113400 chr7D 95.602 1205 49 1 870 2070 65437190 65438394 0.000000e+00 1929.0
8 TraesCS7A01G113400 chr7D 92.645 707 34 15 2308 3005 65438556 65439253 0.000000e+00 1002.0
9 TraesCS7A01G113400 chr7D 90.521 422 36 4 1597 2017 65627000 65626582 3.380000e-154 555.0
10 TraesCS7A01G113400 chr7D 85.671 328 35 6 2 323 65436336 65436657 4.800000e-88 335.0
11 TraesCS7A01G113400 chr7D 95.035 141 5 2 2189 2327 65438391 65438531 1.400000e-53 220.0
12 TraesCS7A01G113400 chr7D 85.167 209 27 4 532 737 65436927 65437134 8.440000e-51 211.0
13 TraesCS7A01G113400 chr7D 84.167 120 15 2 918 1033 65716142 65716023 2.450000e-21 113.0
14 TraesCS7A01G113400 chr7D 95.522 67 2 1 2390 2455 65438727 65438793 4.100000e-19 106.0
15 TraesCS7A01G113400 chr7D 89.474 76 8 0 1096 1171 65666801 65666726 2.470000e-16 97.1
16 TraesCS7A01G113400 chr7D 85.393 89 4 5 8 96 65717016 65716937 1.920000e-12 84.2
17 TraesCS7A01G113400 chr7B 94.802 1212 52 2 870 2070 7038506 7037295 0.000000e+00 1879.0
18 TraesCS7A01G113400 chr7B 93.705 413 22 4 2587 2996 7036774 7036363 1.530000e-172 616.0
19 TraesCS7A01G113400 chr7B 84.483 290 29 12 2308 2588 7037139 7036857 3.820000e-69 272.0
20 TraesCS7A01G113400 chr7B 80.267 375 52 14 2 371 7039353 7038996 2.300000e-66 263.0
21 TraesCS7A01G113400 chr7B 92.806 139 7 3 2190 2327 7037297 7037161 6.570000e-47 198.0
22 TraesCS7A01G113400 chr2B 89.602 981 84 8 1072 2037 110417466 110416489 0.000000e+00 1230.0
23 TraesCS7A01G113400 chr2B 76.542 827 152 36 1181 1998 111041575 111040782 5.990000e-112 414.0
24 TraesCS7A01G113400 chr2D 89.308 982 91 6 1072 2040 73009969 73008989 0.000000e+00 1219.0
25 TraesCS7A01G113400 chr2D 79.701 803 125 32 1181 1976 73316904 73317675 2.040000e-151 545.0
26 TraesCS7A01G113400 chr2A 88.685 981 96 8 1072 2037 71614034 71613054 0.000000e+00 1182.0
27 TraesCS7A01G113400 chr2A 78.624 814 132 33 1181 1985 72697318 72696538 4.470000e-138 501.0
28 TraesCS7A01G113400 chr2A 93.939 66 1 2 2101 2163 736754403 736754468 2.470000e-16 97.1
29 TraesCS7A01G113400 chr3D 81.416 113 19 1 733 843 595074723 595074611 1.150000e-14 91.6


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS7A01G113400 chr7A 69567270 69570274 3004 False 1920.666667 5550 97.014667 1 3005 3 chr7A.!!$F1 3004
1 TraesCS7A01G113400 chr7A 69617622 69620671 3049 False 1366.000000 4388 96.698000 1 3005 4 chr7A.!!$F2 3004
2 TraesCS7A01G113400 chr7D 65436336 65439253 2917 False 633.833333 1929 91.607000 2 3005 6 chr7D.!!$F1 3003
3 TraesCS7A01G113400 chr7B 7036363 7039353 2990 True 645.600000 1879 89.212600 2 2996 5 chr7B.!!$R1 2994
4 TraesCS7A01G113400 chr2B 110416489 110417466 977 True 1230.000000 1230 89.602000 1072 2037 1 chr2B.!!$R1 965
5 TraesCS7A01G113400 chr2B 111040782 111041575 793 True 414.000000 414 76.542000 1181 1998 1 chr2B.!!$R2 817
6 TraesCS7A01G113400 chr2D 73008989 73009969 980 True 1219.000000 1219 89.308000 1072 2040 1 chr2D.!!$R1 968
7 TraesCS7A01G113400 chr2D 73316904 73317675 771 False 545.000000 545 79.701000 1181 1976 1 chr2D.!!$F1 795
8 TraesCS7A01G113400 chr2A 71613054 71614034 980 True 1182.000000 1182 88.685000 1072 2037 1 chr2A.!!$R1 965
9 TraesCS7A01G113400 chr2A 72696538 72697318 780 True 501.000000 501 78.624000 1181 1985 1 chr2A.!!$R2 804

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
517 568 1.27184 ATGCTCCTGGGACGGCTAAA 61.272 55.0 0.0 0.0 0.0 1.85 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2099 2246 0.108945 GGGTCTCCAGTTTACGTCCG 60.109 60.0 0.0 0.0 0.0 4.79 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
56 57 1.383523 GGCTCAACCACTAATCAGGC 58.616 55.000 0.00 0.0 38.86 4.85
242 254 1.468520 CGGCTTCACGATGTTTCCATT 59.531 47.619 0.00 0.0 35.47 3.16
456 507 2.223443 GGTTGGGGCCAGGCAAAAT 61.223 57.895 15.19 0.0 0.00 1.82
517 568 1.271840 ATGCTCCTGGGACGGCTAAA 61.272 55.000 0.00 0.0 0.00 1.85
748 834 7.815383 TGATCCATATTACTCCCTTTGTTCAT 58.185 34.615 0.00 0.0 0.00 2.57
760 846 8.512138 ACTCCCTTTGTTCATTTTTATAAGACG 58.488 33.333 0.00 0.0 0.00 4.18
773 859 6.995511 TTTATAAGACGCTGTAGCCATTTT 57.004 33.333 0.00 0.0 37.91 1.82
784 870 4.651778 TGTAGCCATTTTAGACAGCAGTT 58.348 39.130 0.00 0.0 0.00 3.16
832 918 8.726988 TCTGAAACGTCTTATAAAAATGAAGGG 58.273 33.333 0.00 0.0 0.00 3.95
2099 2246 5.831702 AATCCTATATGACCGGATCGTAC 57.168 43.478 9.46 0.0 36.56 3.67
2717 3012 5.371526 AGGACAATTGTAGAGCACATATGG 58.628 41.667 11.95 0.0 36.90 2.74
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
110 111 8.607459 CAAAATCGTGCTTAGATTGAGATAGTT 58.393 33.333 3.40 0.0 38.24 2.24
242 254 7.445945 CAGGGTGAAATAATTTTTGGGTAACA 58.554 34.615 0.00 0.0 39.74 2.41
517 568 3.771160 CCTAGCCGTGGAAGCCGT 61.771 66.667 0.00 0.0 0.00 5.68
719 805 5.753721 AAGGGAGTAATATGGATCAGAGC 57.246 43.478 0.00 0.0 0.00 4.09
748 834 6.995511 AATGGCTACAGCGTCTTATAAAAA 57.004 33.333 0.00 0.0 43.26 1.94
773 859 9.502091 ACATTGAACTATTTTAACTGCTGTCTA 57.498 29.630 0.00 0.0 0.00 2.59
784 870 9.114952 TCAGACAACACACATTGAACTATTTTA 57.885 29.630 0.00 0.0 33.57 1.52
832 918 5.835911 GTTTAAACGACAAGTACTCCCTC 57.164 43.478 1.89 0.0 0.00 4.30
1912 2049 2.849096 TACCTGGCATCCTCGGACGT 62.849 60.000 0.00 0.0 0.00 4.34
2099 2246 0.108945 GGGTCTCCAGTTTACGTCCG 60.109 60.000 0.00 0.0 0.00 4.79
2820 3117 7.566760 TTTTCTAACTCAGATGTTGCAGAAA 57.433 32.000 0.00 0.0 34.97 2.52


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.