Multiple sequence alignment - TraesCS7A01G099600

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS7A01G099600 chr7A 100.000 3354 0 0 1 3354 60349346 60345993 0 6194
1 TraesCS7A01G099600 chr7B 99.076 3354 30 1 1 3354 716910711 716907359 0 6021
2 TraesCS7A01G099600 chr7B 99.016 3354 31 1 1 3354 742954452 742957803 0 6010
3 TraesCS7A01G099600 chr7B 98.956 3354 33 2 1 3354 716778894 716775543 0 5999
4 TraesCS7A01G099600 chr5A 99.076 3354 30 1 1 3354 16538868 16535516 0 6021
5 TraesCS7A01G099600 chr2B 98.837 3354 38 1 1 3354 391172730 391169378 0 5976
6 TraesCS7A01G099600 chr1B 98.718 3354 41 1 1 3354 583567262 583570613 0 5954
7 TraesCS7A01G099600 chr3B 97.914 3356 68 1 1 3354 39847342 39843987 0 5808


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS7A01G099600 chr7A 60345993 60349346 3353 True 6194 6194 100.000 1 3354 1 chr7A.!!$R1 3353
1 TraesCS7A01G099600 chr7B 716907359 716910711 3352 True 6021 6021 99.076 1 3354 1 chr7B.!!$R2 3353
2 TraesCS7A01G099600 chr7B 742954452 742957803 3351 False 6010 6010 99.016 1 3354 1 chr7B.!!$F1 3353
3 TraesCS7A01G099600 chr7B 716775543 716778894 3351 True 5999 5999 98.956 1 3354 1 chr7B.!!$R1 3353
4 TraesCS7A01G099600 chr5A 16535516 16538868 3352 True 6021 6021 99.076 1 3354 1 chr5A.!!$R1 3353
5 TraesCS7A01G099600 chr2B 391169378 391172730 3352 True 5976 5976 98.837 1 3354 1 chr2B.!!$R1 3353
6 TraesCS7A01G099600 chr1B 583567262 583570613 3351 False 5954 5954 98.718 1 3354 1 chr1B.!!$F1 3353
7 TraesCS7A01G099600 chr3B 39843987 39847342 3355 True 5808 5808 97.914 1 3354 1 chr3B.!!$R1 3353

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
406 407 1.372683 GAGCCACTCAACCTCAGCA 59.627 57.895 0.0 0.0 0.00 4.41 F
855 860 5.622346 AAGAAGTGTTCTCTTTCTCCAGT 57.378 39.130 0.0 0.0 39.61 4.00 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2208 2213 2.153645 CAAGAGCATTGTGGCAGTACA 58.846 47.619 0.0 0.0 35.83 2.90 R
2515 2520 4.329801 GTCATAAGATTGCATGTCGTGTCA 59.670 41.667 0.0 0.0 0.00 3.58 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
293 294 4.516698 ACGAGCTCAATTTCAAAGTGTGAT 59.483 37.500 15.4 0.0 35.70 3.06
406 407 1.372683 GAGCCACTCAACCTCAGCA 59.627 57.895 0.0 0.0 0.00 4.41
822 823 5.809562 ACGAACTTGCATTTGTTGAATCAAA 59.190 32.000 0.0 0.0 40.74 2.69
855 860 5.622346 AAGAAGTGTTCTCTTTCTCCAGT 57.378 39.130 0.0 0.0 39.61 4.00
1689 1694 6.992063 TTGAGTTAGAGATTGAATGAAGGC 57.008 37.500 0.0 0.0 0.00 4.35
2208 2213 3.532641 ACAAGGCTGAGGAAGGATTTT 57.467 42.857 0.0 0.0 0.00 1.82
2541 2546 6.283694 ACACGACATGCAATCTTATGACTAT 58.716 36.000 0.0 0.0 0.00 2.12
3173 3178 5.474876 ACAAATGGCTTCTTCCTTAGTTCTG 59.525 40.000 0.0 0.0 0.00 3.02
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
855 860 2.102420 TCCTGCGAGACTGTTCTTTTCA 59.898 45.455 0.00 0.00 29.47 2.69
937 942 5.079998 TGATTCCTTCTCTAGATAGGGCA 57.920 43.478 16.87 11.71 0.00 5.36
1097 1102 1.612199 GGCTGACGAATAACCAACCCA 60.612 52.381 0.00 0.00 0.00 4.51
1689 1694 2.158449 CCTTGCTTTTCTCTAGTGTGCG 59.842 50.000 0.00 0.00 0.00 5.34
2208 2213 2.153645 CAAGAGCATTGTGGCAGTACA 58.846 47.619 0.00 0.00 35.83 2.90
2327 2332 5.914898 AGCGCCCAGTTATTAAGAAAATT 57.085 34.783 2.29 0.00 0.00 1.82
2515 2520 4.329801 GTCATAAGATTGCATGTCGTGTCA 59.670 41.667 0.00 0.00 0.00 3.58
2541 2546 5.674525 CTGTCAAAGATGAAGGCCATACTA 58.325 41.667 5.01 0.00 37.30 1.82
3173 3178 8.471609 AGTCTAAAAGAGGTGAAAGAGCTATAC 58.528 37.037 0.00 0.00 30.42 1.47


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.