Multiple sequence alignment - TraesCS7A01G099500

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS7A01G099500 chr7A 100.000 2357 0 0 1 2357 60329009 60326653 0 4353
1 TraesCS7A01G099500 chr1A 99.151 2357 20 0 1 2357 238109744 238107388 0 4242
2 TraesCS7A01G099500 chr1A 99.151 2357 20 0 1 2357 238155129 238152773 0 4242
3 TraesCS7A01G099500 chr5A 99.067 2357 22 0 1 2357 16577919 16575563 0 4231
4 TraesCS7A01G099500 chr7D 98.727 2357 27 1 1 2357 579015579 579017932 0 4183
5 TraesCS7A01G099500 chr6B 98.642 2357 28 2 1 2357 596657305 596654953 0 4172
6 TraesCS7A01G099500 chr3B 98.345 2357 37 2 1 2357 483372317 483374671 0 4135


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS7A01G099500 chr7A 60326653 60329009 2356 True 4353 4353 100.000 1 2357 1 chr7A.!!$R1 2356
1 TraesCS7A01G099500 chr1A 238107388 238109744 2356 True 4242 4242 99.151 1 2357 1 chr1A.!!$R1 2356
2 TraesCS7A01G099500 chr1A 238152773 238155129 2356 True 4242 4242 99.151 1 2357 1 chr1A.!!$R2 2356
3 TraesCS7A01G099500 chr5A 16575563 16577919 2356 True 4231 4231 99.067 1 2357 1 chr5A.!!$R1 2356
4 TraesCS7A01G099500 chr7D 579015579 579017932 2353 False 4183 4183 98.727 1 2357 1 chr7D.!!$F1 2356
5 TraesCS7A01G099500 chr6B 596654953 596657305 2352 True 4172 4172 98.642 1 2357 1 chr6B.!!$R1 2356
6 TraesCS7A01G099500 chr3B 483372317 483374671 2354 False 4135 4135 98.345 1 2357 1 chr3B.!!$F1 2356

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
236 237 0.178924 AAAGCAAGGCCTCACCCAAT 60.179 50.000 5.23 0.0 40.58 3.16 F
1018 1019 1.811965 TGATGTCGGAATTTGCACCTG 59.188 47.619 0.00 0.0 0.00 4.00 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1055 1056 0.246635 AGGAACACCGAGTGGAATCG 59.753 55.000 8.57 0.0 42.36 3.34 R
2048 2050 1.956477 ACCACAATTTCCTGCACTGTC 59.044 47.619 0.00 0.0 0.00 3.51 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
163 164 0.966920 TCGTCTTGACCCTGTCTTCC 59.033 55.000 0.00 0.0 33.15 3.46
230 231 3.244875 TGTTCATAGAAAGCAAGGCCTCA 60.245 43.478 5.23 0.0 0.00 3.86
236 237 0.178924 AAAGCAAGGCCTCACCCAAT 60.179 50.000 5.23 0.0 40.58 3.16
485 486 2.024414 GGGTTCGAATCCCATTTCCTG 58.976 52.381 17.16 0.0 44.05 3.86
1018 1019 1.811965 TGATGTCGGAATTTGCACCTG 59.188 47.619 0.00 0.0 0.00 4.00
1055 1056 5.719173 AGTGATCAGTCTGCTAGTTTCTTC 58.281 41.667 0.00 0.0 0.00 2.87
1856 1858 4.102681 GCTAGCTCCCTTTCCCTTATTACA 59.897 45.833 7.70 0.0 0.00 2.41
2048 2050 4.572389 CCGAATTCTGAAATCACTACAGGG 59.428 45.833 3.52 0.0 33.19 4.45
2178 2183 1.062525 GGTTCGCGCTTTATGGCAG 59.937 57.895 5.56 0.0 0.00 4.85
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
147 148 1.150135 AGAGGGAAGACAGGGTCAAGA 59.850 52.381 0.00 0.0 34.60 3.02
163 164 2.678934 TCCGACCCGACCAAGAGG 60.679 66.667 0.00 0.0 42.21 3.69
236 237 0.958091 CAAACCAAATCCGCCACTCA 59.042 50.000 0.00 0.0 0.00 3.41
485 486 2.442188 CGTTCTACTTCCGTGCCGC 61.442 63.158 0.00 0.0 0.00 6.53
1055 1056 0.246635 AGGAACACCGAGTGGAATCG 59.753 55.000 8.57 0.0 42.36 3.34
1856 1858 6.426646 AGAATAGCGGAGAGAAATGGTAAT 57.573 37.500 0.00 0.0 0.00 1.89
2048 2050 1.956477 ACCACAATTTCCTGCACTGTC 59.044 47.619 0.00 0.0 0.00 3.51
2178 2183 4.742438 TGGATTAGTTTGCTCGTTGAAC 57.258 40.909 0.00 0.0 0.00 3.18


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.