Multiple sequence alignment - TraesCS7A01G099400

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS7A01G099400 chr7A 100.000 2378 0 0 1 2378 60328608 60326231 0 4392
1 TraesCS7A01G099400 chr1A 99.369 2378 15 0 1 2378 238154728 238152351 0 4309
2 TraesCS7A01G099400 chr1A 99.285 2378 17 0 1 2378 238109343 238106966 0 4298
3 TraesCS7A01G099400 chr5A 99.201 2378 19 0 1 2378 16577518 16575141 0 4287
4 TraesCS7A01G099400 chr6B 98.780 2378 25 2 1 2378 596656904 596654531 0 4228
5 TraesCS7A01G099400 chr1B 98.570 2378 31 3 1 2378 672508148 672505774 0 4200
6 TraesCS7A01G099400 chr3B 98.486 2378 34 2 1 2378 483372718 483375093 0 4191
7 TraesCS7A01G099400 chrUn 98.486 2378 30 2 1 2378 237257428 237255057 0 4187
8 TraesCS7A01G099400 chr7D 98.524 2372 32 1 1 2372 579015980 579018348 0 4183
9 TraesCS7A01G099400 chr4D 97.855 2378 48 1 1 2378 123520434 123518060 0 4106


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS7A01G099400 chr7A 60326231 60328608 2377 True 4392 4392 100.000 1 2378 1 chr7A.!!$R1 2377
1 TraesCS7A01G099400 chr1A 238152351 238154728 2377 True 4309 4309 99.369 1 2378 1 chr1A.!!$R2 2377
2 TraesCS7A01G099400 chr1A 238106966 238109343 2377 True 4298 4298 99.285 1 2378 1 chr1A.!!$R1 2377
3 TraesCS7A01G099400 chr5A 16575141 16577518 2377 True 4287 4287 99.201 1 2378 1 chr5A.!!$R1 2377
4 TraesCS7A01G099400 chr6B 596654531 596656904 2373 True 4228 4228 98.780 1 2378 1 chr6B.!!$R1 2377
5 TraesCS7A01G099400 chr1B 672505774 672508148 2374 True 4200 4200 98.570 1 2378 1 chr1B.!!$R1 2377
6 TraesCS7A01G099400 chr3B 483372718 483375093 2375 False 4191 4191 98.486 1 2378 1 chr3B.!!$F1 2377
7 TraesCS7A01G099400 chrUn 237255057 237257428 2371 True 4187 4187 98.486 1 2378 1 chrUn.!!$R1 2377
8 TraesCS7A01G099400 chr7D 579015980 579018348 2368 False 4183 4183 98.524 1 2372 1 chr7D.!!$F1 2371
9 TraesCS7A01G099400 chr4D 123518060 123520434 2374 True 4106 4106 97.855 1 2378 1 chr4D.!!$R1 2377

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
617 618 1.811965 TGATGTCGGAATTTGCACCTG 59.188 47.619 0.0 0.0 0.0 4.0 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1647 1648 1.956477 ACCACAATTTCCTGCACTGTC 59.044 47.619 0.0 0.0 0.0 3.51 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
84 85 2.024414 GGGTTCGAATCCCATTTCCTG 58.976 52.381 17.16 0.0 44.05 3.86
617 618 1.811965 TGATGTCGGAATTTGCACCTG 59.188 47.619 0.00 0.0 0.00 4.00
654 655 5.719173 AGTGATCAGTCTGCTAGTTTCTTC 58.281 41.667 0.00 0.0 0.00 2.87
1455 1456 4.102681 GCTAGCTCCCTTTCCCTTATTACA 59.897 45.833 7.70 0.0 0.00 2.41
1647 1648 4.572389 CCGAATTCTGAAATCACTACAGGG 59.428 45.833 3.52 0.0 33.19 4.45
1777 1781 1.062525 GGTTCGCGCTTTATGGCAG 59.937 57.895 5.56 0.0 0.00 4.85
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
84 85 2.442188 CGTTCTACTTCCGTGCCGC 61.442 63.158 0.00 0.0 0.00 6.53
654 655 0.246635 AGGAACACCGAGTGGAATCG 59.753 55.000 8.57 0.0 42.36 3.34
1455 1456 6.426646 AGAATAGCGGAGAGAAATGGTAAT 57.573 37.500 0.00 0.0 0.00 1.89
1647 1648 1.956477 ACCACAATTTCCTGCACTGTC 59.044 47.619 0.00 0.0 0.00 3.51
1777 1781 4.742438 TGGATTAGTTTGCTCGTTGAAC 57.258 40.909 0.00 0.0 0.00 3.18


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.