Multiple sequence alignment - TraesCS7A01G099300

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS7A01G099300 chr7A 100.000 2579 0 0 1 2579 60289763 60292341 0.000000e+00 4763
1 TraesCS7A01G099300 chr7A 98.682 1669 22 0 911 2579 708263722 708262054 0.000000e+00 2961
2 TraesCS7A01G099300 chr4B 98.216 2579 46 0 1 2579 209310098 209312676 0.000000e+00 4508
3 TraesCS7A01G099300 chr2B 97.518 2579 29 9 1 2579 112851667 112854210 0.000000e+00 4375
4 TraesCS7A01G099300 chr2B 97.609 1673 35 4 911 2579 751960902 751959231 0.000000e+00 2863
5 TraesCS7A01G099300 chr2B 97.880 802 17 0 1 802 391184143 391183342 0.000000e+00 1387
6 TraesCS7A01G099300 chr7D 98.626 1674 18 4 911 2579 381946803 381945130 0.000000e+00 2959
7 TraesCS7A01G099300 chr7D 91.645 383 17 3 621 988 382095451 382095833 1.370000e-142 516
8 TraesCS7A01G099300 chr4D 98.625 1673 19 3 911 2579 398050598 398048926 0.000000e+00 2959
9 TraesCS7A01G099300 chr3D 97.847 1672 31 4 912 2579 602854190 602852520 0.000000e+00 2883
10 TraesCS7A01G099300 chr6B 97.727 1672 33 5 912 2578 388166084 388164413 0.000000e+00 2872
11 TraesCS7A01G099300 chr6B 97.491 1674 37 4 911 2579 388358137 388356464 0.000000e+00 2854
12 TraesCS7A01G099300 chrUn 99.001 1401 14 0 1 1401 403079396 403077996 0.000000e+00 2510
13 TraesCS7A01G099300 chrUn 91.645 383 17 3 621 988 325545043 325544661 1.370000e-142 516
14 TraesCS7A01G099300 chrUn 91.645 383 17 3 621 988 325548139 325547757 1.370000e-142 516
15 TraesCS7A01G099300 chr1B 97.821 918 15 1 1 913 339034641 339035558 0.000000e+00 1580
16 TraesCS7A01G099300 chr6A 97.582 827 17 1 1 827 608889745 608890568 0.000000e+00 1413
17 TraesCS7A01G099300 chr7B 99.046 524 5 0 1 524 716899230 716898707 0.000000e+00 941
18 TraesCS7A01G099300 chr7B 99.046 524 5 0 1 524 742999911 743000434 0.000000e+00 941
19 TraesCS7A01G099300 chr7B 98.855 524 6 0 1 524 716863711 716863188 0.000000e+00 935
20 TraesCS7A01G099300 chr5B 96.444 225 2 2 816 1034 127840383 127840159 1.460000e-97 366


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS7A01G099300 chr7A 60289763 60292341 2578 False 4763 4763 100.000 1 2579 1 chr7A.!!$F1 2578
1 TraesCS7A01G099300 chr7A 708262054 708263722 1668 True 2961 2961 98.682 911 2579 1 chr7A.!!$R1 1668
2 TraesCS7A01G099300 chr4B 209310098 209312676 2578 False 4508 4508 98.216 1 2579 1 chr4B.!!$F1 2578
3 TraesCS7A01G099300 chr2B 112851667 112854210 2543 False 4375 4375 97.518 1 2579 1 chr2B.!!$F1 2578
4 TraesCS7A01G099300 chr2B 751959231 751960902 1671 True 2863 2863 97.609 911 2579 1 chr2B.!!$R2 1668
5 TraesCS7A01G099300 chr2B 391183342 391184143 801 True 1387 1387 97.880 1 802 1 chr2B.!!$R1 801
6 TraesCS7A01G099300 chr7D 381945130 381946803 1673 True 2959 2959 98.626 911 2579 1 chr7D.!!$R1 1668
7 TraesCS7A01G099300 chr4D 398048926 398050598 1672 True 2959 2959 98.625 911 2579 1 chr4D.!!$R1 1668
8 TraesCS7A01G099300 chr3D 602852520 602854190 1670 True 2883 2883 97.847 912 2579 1 chr3D.!!$R1 1667
9 TraesCS7A01G099300 chr6B 388164413 388166084 1671 True 2872 2872 97.727 912 2578 1 chr6B.!!$R1 1666
10 TraesCS7A01G099300 chr6B 388356464 388358137 1673 True 2854 2854 97.491 911 2579 1 chr6B.!!$R2 1668
11 TraesCS7A01G099300 chrUn 403077996 403079396 1400 True 2510 2510 99.001 1 1401 1 chrUn.!!$R1 1400
12 TraesCS7A01G099300 chrUn 325544661 325548139 3478 True 516 516 91.645 621 988 2 chrUn.!!$R2 367
13 TraesCS7A01G099300 chr1B 339034641 339035558 917 False 1580 1580 97.821 1 913 1 chr1B.!!$F1 912
14 TraesCS7A01G099300 chr6A 608889745 608890568 823 False 1413 1413 97.582 1 827 1 chr6A.!!$F1 826
15 TraesCS7A01G099300 chr7B 716898707 716899230 523 True 941 941 99.046 1 524 1 chr7B.!!$R2 523
16 TraesCS7A01G099300 chr7B 742999911 743000434 523 False 941 941 99.046 1 524 1 chr7B.!!$F1 523
17 TraesCS7A01G099300 chr7B 716863188 716863711 523 True 935 935 98.855 1 524 1 chr7B.!!$R1 523

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
868 3350 1.338769 GGACCTCCAGTGTATGCGTTT 60.339 52.381 0.0 0.0 35.64 3.6 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1909 4399 2.961741 GGAGATGACTCTGCTGATACCA 59.038 50.0 0.0 0.0 42.28 3.25 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
317 318 2.029649 GTCACTGCTGGCACATTTTCAT 60.030 45.455 0.00 0.0 38.20 2.57
620 621 8.607441 AAAGAAGAAACCAATTTTAAGGCATC 57.393 30.769 0.00 0.0 0.00 3.91
621 622 7.544804 AGAAGAAACCAATTTTAAGGCATCT 57.455 32.000 0.00 0.0 0.00 2.90
622 623 7.606349 AGAAGAAACCAATTTTAAGGCATCTC 58.394 34.615 0.00 0.0 0.00 2.75
623 624 6.286240 AGAAACCAATTTTAAGGCATCTCC 57.714 37.500 0.00 0.0 0.00 3.71
651 3128 7.374272 CCCTCGGTGCATATTATCATATAGAG 58.626 42.308 0.00 0.0 0.00 2.43
696 3173 4.627035 CGTCTTAGACATTTCACTGATGCA 59.373 41.667 13.14 0.0 32.09 3.96
868 3350 1.338769 GGACCTCCAGTGTATGCGTTT 60.339 52.381 0.00 0.0 35.64 3.60
1077 3564 4.641541 CCATCTATTTGTGCATCAAGTCCA 59.358 41.667 0.00 0.0 37.35 4.02
1267 3754 2.710377 CGGAGGAATCCAATGAACACA 58.290 47.619 0.61 0.0 0.00 3.72
1909 4399 4.067192 GGAGCCATTTTGCATTGAAACTT 58.933 39.130 0.00 0.0 0.00 2.66
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
620 621 0.833834 ATATGCACCGAGGGGAGGAG 60.834 60.000 0.0 0.0 36.97 3.69
621 622 0.399949 AATATGCACCGAGGGGAGGA 60.400 55.000 0.0 0.0 36.97 3.71
622 623 1.348064 TAATATGCACCGAGGGGAGG 58.652 55.000 0.0 0.0 36.97 4.30
623 624 2.567169 TGATAATATGCACCGAGGGGAG 59.433 50.000 0.0 0.0 36.97 4.30
624 625 2.615391 TGATAATATGCACCGAGGGGA 58.385 47.619 0.0 0.0 36.97 4.81
696 3173 2.294170 TAGACTCGATTCCCCGCCCT 62.294 60.000 0.0 0.0 0.00 5.19
787 3264 3.872354 CATTTCGTGCTCTTTTTCGTCA 58.128 40.909 0.0 0.0 0.00 4.35
868 3350 2.742053 GACAAAATGCTAGTTGCCTCGA 59.258 45.455 0.0 0.0 42.00 4.04
1039 3526 9.135189 ACAAATAGATGGAATAGCAGCAAATAA 57.865 29.630 0.0 0.0 0.00 1.40
1266 3753 6.709643 CAAGCTGATCCTAAGTAATCGTTTG 58.290 40.000 0.0 0.0 0.00 2.93
1267 3754 5.294552 GCAAGCTGATCCTAAGTAATCGTTT 59.705 40.000 0.0 0.0 0.00 3.60
1909 4399 2.961741 GGAGATGACTCTGCTGATACCA 59.038 50.000 0.0 0.0 42.28 3.25


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.