Multiple sequence alignment - TraesCS7A01G099200

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS7A01G099200 chr7A 100.000 2646 0 0 1 2646 60286001 60283356 0 4887
1 TraesCS7A01G099200 chrUn 98.535 2663 22 3 1 2646 186201715 186204377 0 4686
2 TraesCS7A01G099200 chr7B 98.460 2663 24 1 1 2646 742996151 742993489 0 4674
3 TraesCS7A01G099200 chr7B 98.423 2663 24 3 1 2646 716872076 716874737 0 4669
4 TraesCS7A01G099200 chr7B 98.400 2500 23 1 164 2646 716832023 716834522 0 4379
5 TraesCS7A01G099200 chr7B 94.595 444 7 1 2220 2646 327440416 327439973 0 671
6 TraesCS7A01G099200 chr1A 98.460 2663 21 3 1 2646 498684525 498687184 0 4673
7 TraesCS7A01G099200 chr5A 98.122 2663 33 1 1 2646 492862433 492859771 0 4625
8 TraesCS7A01G099200 chr2B 97.897 2663 39 1 1 2646 391167714 391165052 0 4591
9 TraesCS7A01G099200 chr2B 97.822 2663 38 3 1 2646 112847905 112845246 0 4578
10 TraesCS7A01G099200 chr4A 97.860 2664 38 3 1 2646 67603672 67601010 0 4586
11 TraesCS7A01G099200 chr4B 97.822 2663 39 3 1 2646 209306366 209303706 0 4578
12 TraesCS7A01G099200 chr4B 96.620 1420 31 1 1244 2646 495486207 495487626 0 2340
13 TraesCS7A01G099200 chr3A 97.747 2663 43 1 1 2646 725803458 725800796 0 4569
14 TraesCS7A01G099200 chr4D 96.279 645 7 1 2019 2646 123246027 123246671 0 1042


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS7A01G099200 chr7A 60283356 60286001 2645 True 4887 4887 100.000 1 2646 1 chr7A.!!$R1 2645
1 TraesCS7A01G099200 chrUn 186201715 186204377 2662 False 4686 4686 98.535 1 2646 1 chrUn.!!$F1 2645
2 TraesCS7A01G099200 chr7B 742993489 742996151 2662 True 4674 4674 98.460 1 2646 1 chr7B.!!$R2 2645
3 TraesCS7A01G099200 chr7B 716872076 716874737 2661 False 4669 4669 98.423 1 2646 1 chr7B.!!$F2 2645
4 TraesCS7A01G099200 chr7B 716832023 716834522 2499 False 4379 4379 98.400 164 2646 1 chr7B.!!$F1 2482
5 TraesCS7A01G099200 chr1A 498684525 498687184 2659 False 4673 4673 98.460 1 2646 1 chr1A.!!$F1 2645
6 TraesCS7A01G099200 chr5A 492859771 492862433 2662 True 4625 4625 98.122 1 2646 1 chr5A.!!$R1 2645
7 TraesCS7A01G099200 chr2B 391165052 391167714 2662 True 4591 4591 97.897 1 2646 1 chr2B.!!$R2 2645
8 TraesCS7A01G099200 chr2B 112845246 112847905 2659 True 4578 4578 97.822 1 2646 1 chr2B.!!$R1 2645
9 TraesCS7A01G099200 chr4A 67601010 67603672 2662 True 4586 4586 97.860 1 2646 1 chr4A.!!$R1 2645
10 TraesCS7A01G099200 chr4B 209303706 209306366 2660 True 4578 4578 97.822 1 2646 1 chr4B.!!$R1 2645
11 TraesCS7A01G099200 chr4B 495486207 495487626 1419 False 2340 2340 96.620 1244 2646 1 chr4B.!!$F1 1402
12 TraesCS7A01G099200 chr3A 725800796 725803458 2662 True 4569 4569 97.747 1 2646 1 chr3A.!!$R1 2645
13 TraesCS7A01G099200 chr4D 123246027 123246671 644 False 1042 1042 96.279 2019 2646 1 chr4D.!!$F1 627

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
774 778 1.065551 GGCAAGCATGGACCGAATAAC 59.934 52.381 0.0 0.0 0.0 1.89 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1677 1683 0.640495 TTCCCCGGATAGGAGAAGGT 59.36 55.0 0.73 0.0 45.0 3.5 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
718 722 3.344515 CTCCTCCTAAAACCCTTTTCGG 58.655 50.000 0.00 0.0 36.96 4.30
774 778 1.065551 GGCAAGCATGGACCGAATAAC 59.934 52.381 0.00 0.0 0.00 1.89
1334 1340 1.854126 CTGCACTTTGAAAGCCAAACG 59.146 47.619 4.57 0.0 39.65 3.60
1370 1376 8.099537 CCATATCAACTACTCTCCAAATAGCAT 58.900 37.037 0.00 0.0 0.00 3.79
1677 1683 2.665165 ACAAACAAATGACCCAGCTGA 58.335 42.857 17.39 0.0 0.00 4.26
1785 1791 5.506815 CGGGTTAGTTCACGCTAGATTATCA 60.507 44.000 0.00 0.0 0.00 2.15
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
774 778 6.702282 TCGTCTATCTAGACAGAGTATGTGTG 59.298 42.308 15.63 0.0 45.61 3.82
1334 1340 7.044798 AGAGTAGTTGATATGGTCTTTCTTGC 58.955 38.462 0.00 0.0 0.00 4.01
1370 1376 7.637631 TCCATTTGAATTCCGTGATTTATCA 57.362 32.000 2.27 0.0 0.00 2.15
1624 1630 2.293122 TCAATTCACTCCTGCGGTTTTG 59.707 45.455 0.00 0.0 0.00 2.44
1677 1683 0.640495 TTCCCCGGATAGGAGAAGGT 59.360 55.000 0.73 0.0 45.00 3.50
1785 1791 5.883673 TGTTCTAACAGGTGTTACAAGCTTT 59.116 36.000 0.00 0.0 39.31 3.51
1915 1921 3.706086 ACAAGTTCAAATGGAGCAAACCT 59.294 39.130 0.00 0.0 0.00 3.50
2381 2388 1.557269 GGTCCAGTGAGGTGAGCCAT 61.557 60.000 0.00 0.0 39.02 4.40


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.