Multiple sequence alignment - TraesCS7A01G099100

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS7A01G099100 chr7A 100.000 2231 0 0 1 2231 60280982 60283212 0 4120
1 TraesCS7A01G099100 chr7B 99.059 2232 20 1 1 2231 742991114 742993345 0 4004
2 TraesCS7A01G099100 chr7B 99.014 2232 21 1 1 2231 716877112 716874881 0 3999
3 TraesCS7A01G099100 chrUn 98.970 2232 22 1 1 2231 186206752 186204521 0 3993
4 TraesCS7A01G099100 chr1A 98.924 2231 24 0 1 2231 498689558 498687328 0 3988
5 TraesCS7A01G099100 chr5A 98.569 2236 26 2 1 2231 238821139 238818905 0 3947
6 TraesCS7A01G099100 chr2B 98.566 2231 32 0 1 2231 391162678 391164908 0 3943


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS7A01G099100 chr7A 60280982 60283212 2230 False 4120 4120 100.000 1 2231 1 chr7A.!!$F1 2230
1 TraesCS7A01G099100 chr7B 742991114 742993345 2231 False 4004 4004 99.059 1 2231 1 chr7B.!!$F1 2230
2 TraesCS7A01G099100 chr7B 716874881 716877112 2231 True 3999 3999 99.014 1 2231 1 chr7B.!!$R1 2230
3 TraesCS7A01G099100 chrUn 186204521 186206752 2231 True 3993 3993 98.970 1 2231 1 chrUn.!!$R1 2230
4 TraesCS7A01G099100 chr1A 498687328 498689558 2230 True 3988 3988 98.924 1 2231 1 chr1A.!!$R1 2230
5 TraesCS7A01G099100 chr5A 238818905 238821139 2234 True 3947 3947 98.569 1 2231 1 chr5A.!!$R1 2230
6 TraesCS7A01G099100 chr2B 391162678 391164908 2230 False 3943 3943 98.566 1 2231 1 chr2B.!!$F1 2230

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
310 311 1.079405 GAACGGCGAAGTCCATCCA 60.079 57.895 16.62 0.0 0.0 3.41 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2105 2113 1.002544 GGTGCTTCTACCAGTCAAGCT 59.997 52.381 12.94 0.0 42.6 3.74 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
114 115 5.655532 GTGTAATAGGACTCCCAGTTACTGA 59.344 44.000 14.66 0.00 36.42 3.41
310 311 1.079405 GAACGGCGAAGTCCATCCA 60.079 57.895 16.62 0.00 0.00 3.41
1102 1109 2.370849 TCTTGAAAACGCTCCTAACCCT 59.629 45.455 0.00 0.00 0.00 4.34
1351 1358 7.061566 TCTATATGAACCAATGGATCGTGAA 57.938 36.000 13.66 2.03 0.00 3.18
1864 1872 1.678970 GCATCCCTTGCCGTTTCCT 60.679 57.895 0.00 0.00 46.15 3.36
1893 1901 2.445145 TGAAGTTGGATCAAAGTCCCCA 59.555 45.455 0.00 0.00 37.48 4.96
2022 2030 4.011966 TCTACCCATCTACGCGATTCTA 57.988 45.455 15.93 0.00 0.00 2.10
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
114 115 0.517755 CCTCAGTATACGATCGCGCT 59.482 55.000 16.60 5.27 42.48 5.92
310 311 6.665248 CCTCTTATTTCTTCATTGGAGGGTTT 59.335 38.462 0.00 0.00 36.44 3.27
1102 1109 2.378038 ACTATACACGGCCCTACGAAA 58.622 47.619 0.00 0.00 37.61 3.46
1351 1358 6.921914 AGTCATTGCTAGTAGTAACGACTTT 58.078 36.000 19.77 4.11 39.61 2.66
1864 1872 1.554617 TGATCCAACTTCAGCCGATGA 59.445 47.619 0.00 0.00 35.62 2.92
1893 1901 4.505313 TCTATAATGAGCATTCGCGTCT 57.495 40.909 5.77 0.00 45.49 4.18
2105 2113 1.002544 GGTGCTTCTACCAGTCAAGCT 59.997 52.381 12.94 0.00 42.60 3.74


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.