Multiple sequence alignment - TraesCS7A01G099000

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS7A01G099000 chr7A 100.000 2713 0 0 1 2713 60282780 60280068 0 5011
1 TraesCS7A01G099000 chr5A 99.228 2719 15 2 1 2713 19245370 19248088 0 4900
2 TraesCS7A01G099000 chr7D 99.191 2718 16 2 1 2713 382053550 382050834 0 4892
3 TraesCS7A01G099000 chr7D 98.969 2716 22 2 3 2713 381927470 381924756 0 4855
4 TraesCS7A01G099000 chr7D 98.896 2718 24 2 1 2713 203503470 203500754 0 4848
5 TraesCS7A01G099000 chr7B 99.079 2714 24 1 1 2713 716875313 716878026 0 4872
6 TraesCS7A01G099000 chr7B 99.005 2714 26 1 1 2713 742992913 742990200 0 4861
7 TraesCS7A01G099000 chr7B 98.565 2718 34 2 1 2713 716835098 716837815 0 4798
8 TraesCS7A01G099000 chr1A 99.005 2713 27 0 1 2713 498687760 498690472 0 4861


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS7A01G099000 chr7A 60280068 60282780 2712 True 5011 5011 100.000 1 2713 1 chr7A.!!$R1 2712
1 TraesCS7A01G099000 chr5A 19245370 19248088 2718 False 4900 4900 99.228 1 2713 1 chr5A.!!$F1 2712
2 TraesCS7A01G099000 chr7D 382050834 382053550 2716 True 4892 4892 99.191 1 2713 1 chr7D.!!$R3 2712
3 TraesCS7A01G099000 chr7D 381924756 381927470 2714 True 4855 4855 98.969 3 2713 1 chr7D.!!$R2 2710
4 TraesCS7A01G099000 chr7D 203500754 203503470 2716 True 4848 4848 98.896 1 2713 1 chr7D.!!$R1 2712
5 TraesCS7A01G099000 chr7B 716875313 716878026 2713 False 4872 4872 99.079 1 2713 1 chr7B.!!$F2 2712
6 TraesCS7A01G099000 chr7B 742990200 742992913 2713 True 4861 4861 99.005 1 2713 1 chr7B.!!$R1 2712
7 TraesCS7A01G099000 chr7B 716835098 716837815 2717 False 4798 4798 98.565 1 2713 1 chr7B.!!$F1 2712
8 TraesCS7A01G099000 chr1A 498687760 498690472 2712 False 4861 4861 99.005 1 2713 1 chr1A.!!$F1 2712

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
696 700 2.378038 ACTATACACGGCCCTACGAAA 58.622 47.619 0.0 0.0 37.61 3.46 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1982 2000 3.267597 CTTCGCCGCTTTGGGTTGG 62.268 63.158 0.0 0.0 38.63 3.77 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
447 451 6.921914 AGTCATTGCTAGTAGTAACGACTTT 58.078 36.000 19.77 4.11 39.61 2.66
696 700 2.378038 ACTATACACGGCCCTACGAAA 58.622 47.619 0.00 0.00 37.61 3.46
1488 1506 6.665248 CCTCTTATTTCTTCATTGGAGGGTTT 59.335 38.462 0.00 0.00 36.44 3.27
1684 1702 0.517755 CCTCAGTATACGATCGCGCT 59.482 55.000 16.60 5.27 42.48 5.92
2020 2038 6.469275 GCGAAGAACAAATAGAATTTGCTACC 59.531 38.462 11.32 0.92 32.93 3.18
2150 2168 2.337246 ACGGGTTTGCCGTAATGCC 61.337 57.895 0.00 0.00 42.28 4.40
2161 2179 2.519377 CGTAATGCCGGAACTATGGA 57.481 50.000 5.05 0.00 0.00 3.41
2614 2632 2.409870 GCCGCTGGGGAATTCACAG 61.410 63.158 15.77 19.46 38.47 3.66
2638 2656 7.613411 CAGAAAAGGGAAGGACTTATTCTCAAT 59.387 37.037 0.00 0.00 30.38 2.57
2664 2682 1.040646 AGTGCTCTCTGAACCGAACA 58.959 50.000 0.00 0.00 0.00 3.18
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
447 451 7.061566 TCTATATGAACCAATGGATCGTGAA 57.938 36.000 13.66 2.03 0.00 3.18
696 700 2.370849 TCTTGAAAACGCTCCTAACCCT 59.629 45.455 0.00 0.00 0.00 4.34
1488 1506 1.079405 GAACGGCGAAGTCCATCCA 60.079 57.895 16.62 0.00 0.00 3.41
1684 1702 5.655532 GTGTAATAGGACTCCCAGTTACTGA 59.344 44.000 14.66 0.00 36.42 3.41
1982 2000 3.267597 CTTCGCCGCTTTGGGTTGG 62.268 63.158 0.00 0.00 38.63 3.77
2150 2168 4.000331 AGATGCATTCTCCATAGTTCCG 58.000 45.455 0.00 0.00 0.00 4.30
2161 2179 6.723131 CATCAATGACGATAGATGCATTCT 57.277 37.500 0.00 2.14 35.18 2.40
2614 2632 7.611855 TCATTGAGAATAAGTCCTTCCCTTTTC 59.388 37.037 0.00 0.00 0.00 2.29
2664 2682 5.278463 CCGTCTGATGGAAAACAACTTTCAT 60.278 40.000 10.50 0.00 44.61 2.57


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.