Multiple sequence alignment - TraesCS7A01G098900

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS7A01G098900 chr7A 100.000 2594 0 0 1 2594 60279280 60281873 0 4791
1 TraesCS7A01G098900 chr5A 99.192 2600 15 2 1 2594 19248877 19246278 0 4680
2 TraesCS7A01G098900 chr5A 98.461 2599 34 2 1 2594 238822840 238820243 0 4573
3 TraesCS7A01G098900 chr7D 99.038 2600 19 2 1 2594 382050045 382052644 0 4658
4 TraesCS7A01G098900 chr7D 99.038 2599 20 1 1 2594 381923968 381926566 0 4656
5 TraesCS7A01G098900 chr7D 98.961 2599 22 1 1 2594 203499966 203502564 0 4645
6 TraesCS7A01G098900 chr7D 98.848 2604 17 3 1 2594 381973800 381971200 0 4630
7 TraesCS7A01G098900 chr7B 98.998 2594 25 1 1 2594 716878813 716876221 0 4645
8 TraesCS7A01G098900 chr7B 98.882 2595 27 2 1 2594 742989413 742992006 0 4630
9 TraesCS7A01G098900 chr1A 98.921 2594 28 0 1 2594 498691260 498688667 0 4636


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS7A01G098900 chr7A 60279280 60281873 2593 False 4791 4791 100.000 1 2594 1 chr7A.!!$F1 2593
1 TraesCS7A01G098900 chr5A 19246278 19248877 2599 True 4680 4680 99.192 1 2594 1 chr5A.!!$R1 2593
2 TraesCS7A01G098900 chr5A 238820243 238822840 2597 True 4573 4573 98.461 1 2594 1 chr5A.!!$R2 2593
3 TraesCS7A01G098900 chr7D 382050045 382052644 2599 False 4658 4658 99.038 1 2594 1 chr7D.!!$F3 2593
4 TraesCS7A01G098900 chr7D 381923968 381926566 2598 False 4656 4656 99.038 1 2594 1 chr7D.!!$F2 2593
5 TraesCS7A01G098900 chr7D 203499966 203502564 2598 False 4645 4645 98.961 1 2594 1 chr7D.!!$F1 2593
6 TraesCS7A01G098900 chr7D 381971200 381973800 2600 True 4630 4630 98.848 1 2594 1 chr7D.!!$R1 2593
7 TraesCS7A01G098900 chr7B 716876221 716878813 2592 True 4645 4645 98.998 1 2594 1 chr7B.!!$R1 2593
8 TraesCS7A01G098900 chr7B 742989413 742992006 2593 False 4630 4630 98.882 1 2594 1 chr7B.!!$F1 2593
9 TraesCS7A01G098900 chr1A 498688667 498691260 2593 True 4636 4636 98.921 1 2594 1 chr1A.!!$R1 2593

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
836 838 5.278463 CCGTCTGATGGAAAACAACTTTCAT 60.278 40.0 10.5 0.0 44.61 2.57 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1816 1821 0.517755 CCTCAGTATACGATCGCGCT 59.482 55.0 16.6 5.27 42.48 5.92 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
836 838 5.278463 CCGTCTGATGGAAAACAACTTTCAT 60.278 40.000 10.50 0.00 44.61 2.57
886 888 7.611855 TCATTGAGAATAAGTCCTTCCCTTTTC 59.388 37.037 0.00 0.00 0.00 2.29
1339 1344 6.723131 CATCAATGACGATAGATGCATTCT 57.277 37.500 0.00 2.14 35.18 2.40
1350 1355 4.000331 AGATGCATTCTCCATAGTTCCG 58.000 45.455 0.00 0.00 0.00 4.30
1518 1523 3.267597 CTTCGCCGCTTTGGGTTGG 62.268 63.158 0.00 0.00 38.63 3.77
1816 1821 5.655532 GTGTAATAGGACTCCCAGTTACTGA 59.344 44.000 14.66 0.00 36.42 3.41
2012 2017 1.079405 GAACGGCGAAGTCCATCCA 60.079 57.895 16.62 0.00 0.00 3.41
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
417 419 6.460103 AAGGGATATGCACCTTATCTGAAT 57.540 37.500 4.58 0.00 44.92 2.57
629 631 3.161866 TGGACCCCTTTCTTTATGTTGC 58.838 45.455 0.00 0.00 0.00 4.17
836 838 1.040646 AGTGCTCTCTGAACCGAACA 58.959 50.000 0.00 0.00 0.00 3.18
862 864 7.613411 CAGAAAAGGGAAGGACTTATTCTCAAT 59.387 37.037 0.00 0.00 30.38 2.57
886 888 2.409870 GCCGCTGGGGAATTCACAG 61.410 63.158 15.77 19.46 38.47 3.66
1339 1344 2.519377 CGTAATGCCGGAACTATGGA 57.481 50.000 5.05 0.00 0.00 3.41
1350 1355 2.337246 ACGGGTTTGCCGTAATGCC 61.337 57.895 0.00 0.00 42.28 4.40
1480 1485 6.469275 GCGAAGAACAAATAGAATTTGCTACC 59.531 38.462 11.32 0.92 32.93 3.18
1816 1821 0.517755 CCTCAGTATACGATCGCGCT 59.482 55.000 16.60 5.27 42.48 5.92
2012 2017 6.665248 CCTCTTATTTCTTCATTGGAGGGTTT 59.335 38.462 0.00 0.00 36.44 3.27


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.