Multiple sequence alignment - TraesCS7A01G098800

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS7A01G098800 chr7A 100.000 2440 0 0 1 2440 60280915 60278476 0 4506
1 TraesCS7A01G098800 chr7A 98.689 2440 28 3 1 2440 120839558 120841993 0 4325
2 TraesCS7A01G098800 chr5A 99.223 2444 15 3 1 2440 19247241 19249684 0 4405
3 TraesCS7A01G098800 chr7D 98.976 2441 20 3 1 2440 382051681 382049245 0 4364
4 TraesCS7A01G098800 chr7D 98.894 2442 22 3 1 2440 381925603 381923165 0 4355
5 TraesCS7A01G098800 chr6D 98.893 2440 24 2 1 2440 124519124 124516688 0 4353
6 TraesCS7A01G098800 chr7B 98.853 2441 24 3 1 2440 716877179 716879616 0 4349
7 TraesCS7A01G098800 chr7B 98.771 2442 27 2 1 2440 742991047 742988607 0 4340
8 TraesCS7A01G098800 chr1A 98.852 2440 24 3 1 2440 498689625 498692060 0 4348
9 TraesCS7A01G098800 chr2B 98.281 2443 36 5 1 2440 112842637 112840198 0 4274


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS7A01G098800 chr7A 60278476 60280915 2439 True 4506 4506 100.000 1 2440 1 chr7A.!!$R1 2439
1 TraesCS7A01G098800 chr7A 120839558 120841993 2435 False 4325 4325 98.689 1 2440 1 chr7A.!!$F1 2439
2 TraesCS7A01G098800 chr5A 19247241 19249684 2443 False 4405 4405 99.223 1 2440 1 chr5A.!!$F1 2439
3 TraesCS7A01G098800 chr7D 382049245 382051681 2436 True 4364 4364 98.976 1 2440 1 chr7D.!!$R2 2439
4 TraesCS7A01G098800 chr7D 381923165 381925603 2438 True 4355 4355 98.894 1 2440 1 chr7D.!!$R1 2439
5 TraesCS7A01G098800 chr6D 124516688 124519124 2436 True 4353 4353 98.893 1 2440 1 chr6D.!!$R1 2439
6 TraesCS7A01G098800 chr7B 716877179 716879616 2437 False 4349 4349 98.853 1 2440 1 chr7B.!!$F1 2439
7 TraesCS7A01G098800 chr7B 742988607 742991047 2440 True 4340 4340 98.771 1 2440 1 chr7B.!!$R1 2439
8 TraesCS7A01G098800 chr1A 498689625 498692060 2435 False 4348 4348 98.852 1 2440 1 chr1A.!!$F1 2439
9 TraesCS7A01G098800 chr2B 112840198 112842637 2439 True 4274 4274 98.281 1 2440 1 chr2B.!!$R1 2439

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
799 800 1.040646 AGTGCTCTCTGAACCGAACA 58.959 50.0 0.0 0.0 0.0 3.18 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1924 1944 1.152546 GGGTGTTTGTGGGGAGCTT 60.153 57.895 0.0 0.0 0.0 3.74 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
155 156 6.469275 GCGAAGAACAAATAGAATTTGCTACC 59.531 38.462 11.32 0.92 32.93 3.18
285 286 2.337246 ACGGGTTTGCCGTAATGCC 61.337 57.895 0.00 0.00 42.28 4.40
296 297 2.519377 CGTAATGCCGGAACTATGGA 57.481 50.000 5.05 0.00 0.00 3.41
749 750 2.409870 GCCGCTGGGGAATTCACAG 61.410 63.158 15.77 19.46 38.47 3.66
773 774 7.613411 CAGAAAAGGGAAGGACTTATTCTCAAT 59.387 37.037 0.00 0.00 30.38 2.57
799 800 1.040646 AGTGCTCTCTGAACCGAACA 58.959 50.000 0.00 0.00 0.00 3.18
1006 1007 3.161866 TGGACCCCTTTCTTTATGTTGC 58.838 45.455 0.00 0.00 0.00 4.17
1218 1220 6.460103 AAGGGATATGCACCTTATCTGAAT 57.540 37.500 4.58 0.00 44.92 2.57
1641 1646 7.329962 CCCAAAAACGAACTCTGTTTACTTTTT 59.670 33.333 0.00 0.00 38.52 1.94
1888 1903 5.578776 GTCACGGACTTTTTCTTTGTTCAT 58.421 37.500 0.00 0.00 0.00 2.57
2342 2364 1.756538 CCATAAAGCCGCCAAGGAAAT 59.243 47.619 0.00 0.00 45.00 2.17
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
117 118 3.267597 CTTCGCCGCTTTGGGTTGG 62.268 63.158 0.0 0.00 38.63 3.77
285 286 4.000331 AGATGCATTCTCCATAGTTCCG 58.000 45.455 0.0 0.00 0.00 4.30
296 297 6.723131 CATCAATGACGATAGATGCATTCT 57.277 37.500 0.0 2.14 35.18 2.40
749 750 7.611855 TCATTGAGAATAAGTCCTTCCCTTTTC 59.388 37.037 0.0 0.00 0.00 2.29
799 800 5.278463 CCGTCTGATGGAAAACAACTTTCAT 60.278 40.000 10.5 0.00 44.61 2.57
1924 1944 1.152546 GGGTGTTTGTGGGGAGCTT 60.153 57.895 0.0 0.00 0.00 3.74
2342 2364 4.079980 TGATGAAAGGGAACGAACTTCA 57.920 40.909 0.0 0.00 0.00 3.02


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.