Multiple sequence alignment - TraesCS7A01G098700

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS7A01G098700 chr7A 100.000 2572 0 0 1 2572 60274667 60277238 0 4750
1 TraesCS7A01G098700 chr7A 98.330 2575 34 7 1 2572 120845799 120843231 0 4508
2 TraesCS7A01G098700 chr5A 98.757 2574 30 2 1 2572 19253496 19250923 0 4575
3 TraesCS7A01G098700 chr7B 98.640 2574 33 2 1 2572 716883428 716880855 0 4558
4 TraesCS7A01G098700 chr7B 98.524 2574 35 3 1 2572 716843187 716840615 0 4540
5 TraesCS7A01G098700 chr7B 98.485 2574 35 3 1 2572 742984797 742987368 0 4534
6 TraesCS7A01G098700 chr7D 98.329 2574 31 6 1 2572 203495362 203497925 0 4505
7 TraesCS7A01G098700 chr7D 98.019 2574 39 5 1 2572 381978399 381975836 0 4460
8 TraesCS7A01G098700 chr2B 97.902 2574 50 3 1 2572 112836389 112838960 0 4451


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS7A01G098700 chr7A 60274667 60277238 2571 False 4750 4750 100.000 1 2572 1 chr7A.!!$F1 2571
1 TraesCS7A01G098700 chr7A 120843231 120845799 2568 True 4508 4508 98.330 1 2572 1 chr7A.!!$R1 2571
2 TraesCS7A01G098700 chr5A 19250923 19253496 2573 True 4575 4575 98.757 1 2572 1 chr5A.!!$R1 2571
3 TraesCS7A01G098700 chr7B 716880855 716883428 2573 True 4558 4558 98.640 1 2572 1 chr7B.!!$R2 2571
4 TraesCS7A01G098700 chr7B 716840615 716843187 2572 True 4540 4540 98.524 1 2572 1 chr7B.!!$R1 2571
5 TraesCS7A01G098700 chr7B 742984797 742987368 2571 False 4534 4534 98.485 1 2572 1 chr7B.!!$F1 2571
6 TraesCS7A01G098700 chr7D 203495362 203497925 2563 False 4505 4505 98.329 1 2572 1 chr7D.!!$F1 2571
7 TraesCS7A01G098700 chr7D 381975836 381978399 2563 True 4460 4460 98.019 1 2572 1 chr7D.!!$R1 2571
8 TraesCS7A01G098700 chr2B 112836389 112838960 2571 False 4451 4451 97.902 1 2572 1 chr2B.!!$F1 2571

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
755 757 1.847818 CGATGGTTTAGCGGATTCGA 58.152 50.0 0.0 0.0 39.0 3.71 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2335 2339 5.934625 AGATTTACAGTCTGTCGCTTTTGAT 59.065 36.0 9.26 0.0 0.0 2.57 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
43 44 5.163602 CCTTACTAGTGAGTACTGCTTCCAG 60.164 48.000 13.16 0.00 37.91 3.86
85 86 6.923508 GCTTTGTATTGTAGAAACCTTGCTTT 59.076 34.615 0.00 0.00 0.00 3.51
261 262 3.214328 AGGCAACCCTTTAGATATTGCG 58.786 45.455 0.00 0.00 45.21 4.85
715 717 7.902087 AGGATCAGAATAAGTACTAATGCTCC 58.098 38.462 0.00 2.13 0.00 4.70
716 718 7.732593 AGGATCAGAATAAGTACTAATGCTCCT 59.267 37.037 0.00 4.34 0.00 3.69
755 757 1.847818 CGATGGTTTAGCGGATTCGA 58.152 50.000 0.00 0.00 39.00 3.71
1205 1207 2.837591 TGGATCATCCCTCTCGAAAACA 59.162 45.455 0.00 0.00 35.03 2.83
1253 1255 5.494724 ACTGAGTACTCGGTATAACTCACA 58.505 41.667 31.58 3.90 46.57 3.58
1486 1488 4.880759 ACGCTATGATGATCCAGAGAAAG 58.119 43.478 2.77 0.00 0.00 2.62
1620 1623 5.658190 CAGGGGACAAATCAATAGGAAATGT 59.342 40.000 0.00 0.00 32.85 2.71
1828 1832 6.535150 CGGTTTCATTGATAGCAGAAGAGTAA 59.465 38.462 7.02 0.00 0.00 2.24
1830 1834 7.011857 GGTTTCATTGATAGCAGAAGAGTAAGG 59.988 40.741 2.04 0.00 0.00 2.69
2395 2399 1.134788 CGTAGGTTCGAATCCTGCCTT 60.135 52.381 22.04 1.05 34.90 4.35
2491 2496 2.054140 TTTTGCCGTGCCGTGAAGTC 62.054 55.000 0.00 0.00 0.00 3.01
2492 2497 2.933878 TTTGCCGTGCCGTGAAGTCT 62.934 55.000 0.00 0.00 0.00 3.24
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
85 86 8.651391 TCAACTTAATTCAACTGTACGAGAAA 57.349 30.769 0.00 0.00 0.00 2.52
123 124 0.107703 TCATCCGCAGTTAAGGCAGG 60.108 55.000 0.57 2.86 0.00 4.85
468 470 9.191995 GTTGGATATTGACAAAACGAAAAAGAT 57.808 29.630 0.00 0.00 0.00 2.40
715 717 5.535333 TCGCTCGGGGAAAAGTATTATAAG 58.465 41.667 0.00 0.00 0.00 1.73
716 718 5.534207 TCGCTCGGGGAAAAGTATTATAA 57.466 39.130 0.00 0.00 0.00 0.98
755 757 3.515104 CCCAGGATGCTTGGTTACAATTT 59.485 43.478 0.00 0.00 35.73 1.82
1253 1255 3.375610 TGCACTTGTTTGTACACGAATGT 59.624 39.130 0.00 0.00 43.30 2.71
2335 2339 5.934625 AGATTTACAGTCTGTCGCTTTTGAT 59.065 36.000 9.26 0.00 0.00 2.57
2395 2399 6.325545 TCTCTTAAGTCTACAACAAGTGGGAA 59.674 38.462 1.63 0.00 0.00 3.97
2491 2496 8.804743 TCTCTAAAACGCATACGAGAAAATTAG 58.195 33.333 0.00 0.00 43.93 1.73
2492 2497 8.692110 TCTCTAAAACGCATACGAGAAAATTA 57.308 30.769 0.00 0.00 43.93 1.40


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.