Multiple sequence alignment - TraesCS7A01G098600

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS7A01G098600 chr7A 100.000 4000 0 0 1 4000 60261755 60265754 0 7387
1 TraesCS7A01G098600 chr7A 97.783 4014 63 12 1 4000 120858697 120854696 0 6896
2 TraesCS7A01G098600 chr7A 97.707 3096 60 4 912 4000 46420278 46423369 0 5313
3 TraesCS7A01G098600 chrUn 99.301 4003 25 2 1 4000 206781099 206785101 0 7234
4 TraesCS7A01G098600 chr4D 98.535 4026 32 8 1 4000 123317902 123321926 0 7083
5 TraesCS7A01G098600 chr4D 97.802 2366 25 7 1 2342 123274511 123276873 0 4056
6 TraesCS7A01G098600 chr1B 98.505 4014 39 7 1 4000 672571660 672567654 0 7060
7 TraesCS7A01G098600 chr3B 97.663 4022 65 8 1 4000 483383144 483387158 0 6879
8 TraesCS7A01G098600 chr3B 97.463 4021 77 8 1 4000 669798089 669794073 0 6837
9 TraesCS7A01G098600 chr3D 97.265 4022 75 14 1 3998 523765776 523769786 0 6785
10 TraesCS7A01G098600 chr2B 98.216 3139 45 4 872 4000 391093547 391090410 0 5476
11 TraesCS7A01G098600 chr2B 97.580 2686 49 5 1 2673 112823531 112826213 0 4586
12 TraesCS7A01G098600 chr2B 96.370 1405 32 5 1 1391 357568765 357570164 0 2294
13 TraesCS7A01G098600 chr5A 98.256 3096 44 4 912 4000 238849203 238846111 0 5409
14 TraesCS7A01G098600 chr3A 98.394 2677 29 3 1 2663 633130457 633133133 0 4693


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS7A01G098600 chr7A 60261755 60265754 3999 False 7387 7387 100.000 1 4000 1 chr7A.!!$F2 3999
1 TraesCS7A01G098600 chr7A 120854696 120858697 4001 True 6896 6896 97.783 1 4000 1 chr7A.!!$R1 3999
2 TraesCS7A01G098600 chr7A 46420278 46423369 3091 False 5313 5313 97.707 912 4000 1 chr7A.!!$F1 3088
3 TraesCS7A01G098600 chrUn 206781099 206785101 4002 False 7234 7234 99.301 1 4000 1 chrUn.!!$F1 3999
4 TraesCS7A01G098600 chr4D 123317902 123321926 4024 False 7083 7083 98.535 1 4000 1 chr4D.!!$F2 3999
5 TraesCS7A01G098600 chr4D 123274511 123276873 2362 False 4056 4056 97.802 1 2342 1 chr4D.!!$F1 2341
6 TraesCS7A01G098600 chr1B 672567654 672571660 4006 True 7060 7060 98.505 1 4000 1 chr1B.!!$R1 3999
7 TraesCS7A01G098600 chr3B 483383144 483387158 4014 False 6879 6879 97.663 1 4000 1 chr3B.!!$F1 3999
8 TraesCS7A01G098600 chr3B 669794073 669798089 4016 True 6837 6837 97.463 1 4000 1 chr3B.!!$R1 3999
9 TraesCS7A01G098600 chr3D 523765776 523769786 4010 False 6785 6785 97.265 1 3998 1 chr3D.!!$F1 3997
10 TraesCS7A01G098600 chr2B 391090410 391093547 3137 True 5476 5476 98.216 872 4000 1 chr2B.!!$R1 3128
11 TraesCS7A01G098600 chr2B 112823531 112826213 2682 False 4586 4586 97.580 1 2673 1 chr2B.!!$F1 2672
12 TraesCS7A01G098600 chr2B 357568765 357570164 1399 False 2294 2294 96.370 1 1391 1 chr2B.!!$F2 1390
13 TraesCS7A01G098600 chr5A 238846111 238849203 3092 True 5409 5409 98.256 912 4000 1 chr5A.!!$R1 3088
14 TraesCS7A01G098600 chr3A 633130457 633133133 2676 False 4693 4693 98.394 1 2663 1 chr3A.!!$F1 2662

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
120 121 3.070018 GTCGATAGGGCATTCCAATCTG 58.930 50.000 0.00 0.0 38.24 2.90 F
1192 1221 0.800012 GTTGGTTCGCGCTTTATGGA 59.200 50.000 5.56 0.0 0.00 3.41 F
1669 1698 1.065491 AGCCTGCAATGTCCGATAACA 60.065 47.619 0.00 0.0 0.00 2.41 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1699 1728 2.095059 CCAAAGTTGTATGCCACTGCTC 60.095 50.0 0.0 0.0 38.71 4.26 R
2470 2515 2.606751 CCCCCTCTATGAGACCGTAT 57.393 55.0 0.0 0.0 0.00 3.06 R
3537 3582 2.292828 AAAAAGAGCTGGCTTGGCTA 57.707 45.0 0.0 0.0 40.40 3.93 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
120 121 3.070018 GTCGATAGGGCATTCCAATCTG 58.930 50.000 0.00 0.00 38.24 2.90
1192 1221 0.800012 GTTGGTTCGCGCTTTATGGA 59.200 50.000 5.56 0.00 0.00 3.41
1391 1420 3.181465 GGACATCAATGGTATCGGAGTGT 60.181 47.826 0.00 0.00 0.00 3.55
1669 1698 1.065491 AGCCTGCAATGTCCGATAACA 60.065 47.619 0.00 0.00 0.00 2.41
1699 1728 2.898729 AGTGAATCTATCGGCACCAG 57.101 50.000 0.00 0.00 31.85 4.00
2426 2471 2.125512 CTGGGCGAGAAAGGGTCG 60.126 66.667 0.00 0.00 40.50 4.79
2470 2515 1.895020 CTTCGATTCCACCGGGGTCA 61.895 60.000 6.32 0.00 38.11 4.02
3285 3330 3.722908 GGAAGACTCCTTTTAAGGCCT 57.277 47.619 0.00 0.00 46.06 5.19
3537 3582 7.881751 AGCAATATGTCATATGCTTGATGTACT 59.118 33.333 17.20 2.22 30.70 2.73
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
895 911 3.857194 ACGAAACATTCTTTCACGAACG 58.143 40.909 0.00 0.0 0.00 3.95
1025 1054 4.832248 ACAAAGAGCGATTGTGAGGAATA 58.168 39.130 4.38 0.0 39.43 1.75
1192 1221 6.325919 TGGATTAGTTTGCTCGTTGAAATT 57.674 33.333 0.00 0.0 0.00 1.82
1669 1698 4.279671 CGATAGATTCACTACTGAAGCCCT 59.720 45.833 0.00 0.0 42.78 5.19
1699 1728 2.095059 CCAAAGTTGTATGCCACTGCTC 60.095 50.000 0.00 0.0 38.71 4.26
2426 2471 3.060602 CGCTTACTAATAGGCAAGAGGC 58.939 50.000 7.73 0.0 43.74 4.70
2470 2515 2.606751 CCCCCTCTATGAGACCGTAT 57.393 55.000 0.00 0.0 0.00 3.06
3285 3330 4.287845 TCCTATCGCTCCTATGTAGTGGTA 59.712 45.833 0.00 0.0 0.00 3.25
3537 3582 2.292828 AAAAAGAGCTGGCTTGGCTA 57.707 45.000 0.00 0.0 40.40 3.93


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.