Multiple sequence alignment - TraesCS7A01G098400

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS7A01G098400 chr7A 100.000 3354 0 0 1 3354 60174237 60177590 0 6194
1 TraesCS7A01G098400 chr7A 98.194 3378 36 3 1 3354 60349345 60345969 0 5877
2 TraesCS7A01G098400 chr5A 98.135 3378 37 3 1 3354 16538867 16535492 0 5866
3 TraesCS7A01G098400 chr5A 97.791 2037 21 4 1342 3354 420179133 420177097 0 3491
4 TraesCS7A01G098400 chr7B 98.046 3378 40 3 1 3354 716910710 716907335 0 5849
5 TraesCS7A01G098400 chr7B 98.046 3378 39 3 1 3354 742954453 742957827 0 5847
6 TraesCS7A01G098400 chr7B 97.957 3378 42 4 1 3354 716778893 716775519 0 5830
7 TraesCS7A01G098400 chr1B 97.987 3378 41 7 1 3354 583567263 583570637 0 5836
8 TraesCS7A01G098400 chrUn 97.987 3378 31 6 1 3354 182449172 182445808 0 5827
9 TraesCS7A01G098400 chrUn 97.920 2548 29 4 831 3354 189423451 189425998 0 4390
10 TraesCS7A01G098400 chrUn 97.448 1646 18 4 1733 3354 222877108 222875463 0 2785
11 TraesCS7A01G098400 chrUn 98.969 485 5 0 2870 3354 437475750 437475266 0 869
12 TraesCS7A01G098400 chr2B 97.928 3378 44 4 1 3354 391172729 391169354 0 5827
13 TraesCS7A01G098400 chr4D 97.573 3378 45 7 1 3354 123638864 123642228 0 5749
14 TraesCS7A01G098400 chr6A 97.984 3225 39 3 1 3201 9655983 9652761 0 5572
15 TraesCS7A01G098400 chr6A 97.845 3016 40 3 1 2992 9700187 9697173 0 5186
16 TraesCS7A01G098400 chr7D 97.641 3052 31 6 327 3354 382102547 382099513 0 5199


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS7A01G098400 chr7A 60174237 60177590 3353 False 6194 6194 100.000 1 3354 1 chr7A.!!$F1 3353
1 TraesCS7A01G098400 chr7A 60345969 60349345 3376 True 5877 5877 98.194 1 3354 1 chr7A.!!$R1 3353
2 TraesCS7A01G098400 chr5A 16535492 16538867 3375 True 5866 5866 98.135 1 3354 1 chr5A.!!$R1 3353
3 TraesCS7A01G098400 chr5A 420177097 420179133 2036 True 3491 3491 97.791 1342 3354 1 chr5A.!!$R2 2012
4 TraesCS7A01G098400 chr7B 716907335 716910710 3375 True 5849 5849 98.046 1 3354 1 chr7B.!!$R2 3353
5 TraesCS7A01G098400 chr7B 742954453 742957827 3374 False 5847 5847 98.046 1 3354 1 chr7B.!!$F1 3353
6 TraesCS7A01G098400 chr7B 716775519 716778893 3374 True 5830 5830 97.957 1 3354 1 chr7B.!!$R1 3353
7 TraesCS7A01G098400 chr1B 583567263 583570637 3374 False 5836 5836 97.987 1 3354 1 chr1B.!!$F1 3353
8 TraesCS7A01G098400 chrUn 182445808 182449172 3364 True 5827 5827 97.987 1 3354 1 chrUn.!!$R1 3353
9 TraesCS7A01G098400 chrUn 189423451 189425998 2547 False 4390 4390 97.920 831 3354 1 chrUn.!!$F1 2523
10 TraesCS7A01G098400 chrUn 222875463 222877108 1645 True 2785 2785 97.448 1733 3354 1 chrUn.!!$R2 1621
11 TraesCS7A01G098400 chr2B 391169354 391172729 3375 True 5827 5827 97.928 1 3354 1 chr2B.!!$R1 3353
12 TraesCS7A01G098400 chr4D 123638864 123642228 3364 False 5749 5749 97.573 1 3354 1 chr4D.!!$F1 3353
13 TraesCS7A01G098400 chr6A 9652761 9655983 3222 True 5572 5572 97.984 1 3201 1 chr6A.!!$R1 3200
14 TraesCS7A01G098400 chr6A 9697173 9700187 3014 True 5186 5186 97.845 1 2992 1 chr6A.!!$R2 2991
15 TraesCS7A01G098400 chr7D 382099513 382102547 3034 True 5199 5199 97.641 327 3354 1 chr7D.!!$R1 3027

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
114 115 0.750850 TTAGCGGATCACAGGGCTAC 59.249 55.0 0.0 0.0 37.69 3.58 F
464 465 3.246619 GCAGTCAAAACTCTCCTCTACG 58.753 50.0 0.0 0.0 31.71 3.51 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1092 1096 2.937799 GACGAATAACCAACCCGCAATA 59.062 45.455 0.0 0.0 0.0 1.90 R
2435 2439 4.437794 CGTGAACAGCTAACCATCGTACTA 60.438 45.833 0.0 0.0 0.0 1.82 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
114 115 0.750850 TTAGCGGATCACAGGGCTAC 59.249 55.000 0.00 0.0 37.69 3.58
464 465 3.246619 GCAGTCAAAACTCTCCTCTACG 58.753 50.000 0.00 0.0 31.71 3.51
2030 2034 4.694982 TGTTGTGTGCATATTAGTCACTGG 59.305 41.667 0.00 0.0 0.00 4.00
2114 2118 3.507233 TGAAGCAATGGAAAGAAGCGAAT 59.493 39.130 0.00 0.0 0.00 3.34
2249 2253 7.795047 TCTTGATAGAAGGAAGCATGAATACA 58.205 34.615 0.00 0.0 0.00 2.29
2250 2254 8.435187 TCTTGATAGAAGGAAGCATGAATACAT 58.565 33.333 0.00 0.0 37.19 2.29
2435 2439 6.192970 AGATCGAACCTATCCCATTTTGAT 57.807 37.500 0.00 0.0 0.00 2.57
2509 2513 8.630037 ACATATGAGAATCTGTACACGATACAA 58.370 33.333 10.38 0.0 34.92 2.41
2526 2530 5.164167 CGATACAAAATAACGACACGACACA 60.164 40.000 0.00 0.0 0.00 3.72
2850 2854 3.695060 CCAGGAACGTCATCTACTACTGT 59.305 47.826 0.00 0.0 0.00 3.55
3288 3316 2.364324 ACCGTATCGCATCCAATACAGT 59.636 45.455 0.00 0.0 0.00 3.55
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
114 115 1.421485 GTTCTGGCATGCTTCGACG 59.579 57.895 18.92 0.14 0.00 5.12
1092 1096 2.937799 GACGAATAACCAACCCGCAATA 59.062 45.455 0.00 0.00 0.00 1.90
1777 1781 4.811969 TTCATAGTTCGCTTCAGGGTTA 57.188 40.909 0.00 0.00 0.00 2.85
2249 2253 7.080353 TCCTATTTCAACTAGGTAGGCCTTAT 58.920 38.462 12.58 0.00 44.18 1.73
2250 2254 6.446451 TCCTATTTCAACTAGGTAGGCCTTA 58.554 40.000 12.58 0.00 44.18 2.69
2435 2439 4.437794 CGTGAACAGCTAACCATCGTACTA 60.438 45.833 0.00 0.00 0.00 1.82
2509 2513 4.748102 AGATTGTGTGTCGTGTCGTTATTT 59.252 37.500 0.00 0.00 0.00 1.40
2526 2530 6.327626 AGGCCATACTGTAGTCATAAGATTGT 59.672 38.462 5.01 0.00 0.00 2.71
2866 2870 1.064825 TGTTCTTCCTCCCCACTTCC 58.935 55.000 0.00 0.00 0.00 3.46
2868 2872 0.771755 GGTGTTCTTCCTCCCCACTT 59.228 55.000 0.00 0.00 0.00 3.16
2999 3027 6.537566 CATCGAAGGCGGATAAATTCAATAG 58.462 40.000 0.00 0.00 38.28 1.73
3201 3229 6.398234 AGCATCTGAGTACAATAGTGTAGG 57.602 41.667 2.71 0.00 40.94 3.18
3288 3316 4.076394 GGTTAGGTCAACTTGTGGCATAA 58.924 43.478 0.00 0.00 35.82 1.90


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.