Multiple sequence alignment - TraesCS7A01G098300

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS7A01G098300 chr7A 100.000 3530 0 0 1 3530 60170759 60167230 0 6519
1 TraesCS7A01G098300 chr7A 99.255 3355 23 2 176 3530 60083121 60086473 0 6056
2 TraesCS7A01G098300 chr7B 99.263 3530 26 0 1 3530 742950730 742947201 0 6375
3 TraesCS7A01G098300 chr7B 98.867 3531 38 2 1 3530 716782615 716786144 0 6298
4 TraesCS7A01G098300 chr5A 99.037 3530 33 1 1 3530 420183711 420187239 0 6329
5 TraesCS7A01G098300 chr5A 99.255 3488 26 0 43 3530 16542604 16546091 0 6298
6 TraesCS7A01G098300 chr2A 98.905 3470 37 1 1 3469 755478556 755482025 0 6196
7 TraesCS7A01G098300 chr6B 97.819 3530 75 2 1 3530 388289028 388285501 0 6091
8 TraesCS7A01G098300 chr4D 98.667 3300 42 2 1 3299 123348130 123351428 0 5849
9 TraesCS7A01G098300 chr2D 96.431 3530 111 11 1 3530 291771628 291775142 0 5806


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS7A01G098300 chr7A 60167230 60170759 3529 True 6519 6519 100.000 1 3530 1 chr7A.!!$R1 3529
1 TraesCS7A01G098300 chr7A 60083121 60086473 3352 False 6056 6056 99.255 176 3530 1 chr7A.!!$F1 3354
2 TraesCS7A01G098300 chr7B 742947201 742950730 3529 True 6375 6375 99.263 1 3530 1 chr7B.!!$R1 3529
3 TraesCS7A01G098300 chr7B 716782615 716786144 3529 False 6298 6298 98.867 1 3530 1 chr7B.!!$F1 3529
4 TraesCS7A01G098300 chr5A 420183711 420187239 3528 False 6329 6329 99.037 1 3530 1 chr5A.!!$F2 3529
5 TraesCS7A01G098300 chr5A 16542604 16546091 3487 False 6298 6298 99.255 43 3530 1 chr5A.!!$F1 3487
6 TraesCS7A01G098300 chr2A 755478556 755482025 3469 False 6196 6196 98.905 1 3469 1 chr2A.!!$F1 3468
7 TraesCS7A01G098300 chr6B 388285501 388289028 3527 True 6091 6091 97.819 1 3530 1 chr6B.!!$R1 3529
8 TraesCS7A01G098300 chr4D 123348130 123351428 3298 False 5849 5849 98.667 1 3299 1 chr4D.!!$F1 3298
9 TraesCS7A01G098300 chr2D 291771628 291775142 3514 False 5806 5806 96.431 1 3530 1 chr2D.!!$F1 3529

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
744 748 1.568606 GGCCGATTCCTTAACGAGAC 58.431 55.0 0.0 0.0 0.0 3.36 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2547 2551 1.269831 CCTACATCTGCGAGTAAGGGC 60.27 57.143 0.0 0.0 0.0 5.19 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
132 133 7.137567 AGTAGTGGGTTATTGGAAGTATAGGT 58.862 38.462 0.00 0.0 0.00 3.08
302 303 8.673711 CATAAAGAACGGTAGATTCCATTCAAA 58.326 33.333 0.00 0.0 32.89 2.69
440 441 8.646900 TGAAAGGTTTTGGATTATTAGCAAAGT 58.353 29.630 0.00 0.0 0.00 2.66
744 748 1.568606 GGCCGATTCCTTAACGAGAC 58.431 55.000 0.00 0.0 0.00 3.36
1912 1916 6.606241 TCCCAGGGGATGTTTTCTATTTAT 57.394 37.500 5.33 0.0 39.76 1.40
2380 2384 1.945394 GCTTCTGTGATCGAATGCCAT 59.055 47.619 0.00 0.0 0.00 4.40
2547 2551 7.216494 ACCTGTGAATTAATCAAAAAGGTTGG 58.784 34.615 2.42 0.0 42.02 3.77
3155 3160 3.538379 CCATTTTGGGCTTTGCTCC 57.462 52.632 0.00 0.0 32.67 4.70
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
132 133 6.361433 TCCTTGGTGACACTTGAGAAATAAA 58.639 36.000 5.39 0.00 42.67 1.40
302 303 1.844497 GGTAAGGGCTTGACCTACCAT 59.156 52.381 12.97 0.00 40.87 3.55
440 441 9.363401 TGCCTAGCTGAGTAATAAGATAAGTAA 57.637 33.333 0.00 0.00 0.00 2.24
744 748 2.202892 GGGCGCTTTCGACTAGGG 60.203 66.667 7.64 6.46 44.85 3.53
1393 1397 0.786435 ATCCCTGGGGCTTTCACTTT 59.214 50.000 14.00 0.00 34.68 2.66
1527 1531 7.644986 AGTATCGATAGCTATTGCAGTTTTC 57.355 36.000 15.27 0.00 42.74 2.29
2547 2551 1.269831 CCTACATCTGCGAGTAAGGGC 60.270 57.143 0.00 0.00 0.00 5.19
3155 3160 1.745087 ACAATGCAATAGCTTCGGTGG 59.255 47.619 0.00 0.00 42.74 4.61


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.