Multiple sequence alignment - TraesCS7A01G098200

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS7A01G098200 chr7A 100.000 2342 0 0 1 2342 60168866 60166525 0.000000e+00 4325.0
1 TraesCS7A01G098200 chr7A 99.274 2342 17 0 1 2342 60084837 60087178 0.000000e+00 4231.0
2 TraesCS7A01G098200 chr7A 96.899 129 3 1 2085 2212 627151653 627151781 5.070000e-52 215.0
3 TraesCS7A01G098200 chr7A 100.000 50 0 0 2293 2342 126126779 126126730 2.480000e-15 93.5
4 TraesCS7A01G098200 chr5A 99.402 2342 14 0 1 2342 16544455 16546796 0.000000e+00 4248.0
5 TraesCS7A01G098200 chr5A 98.719 2342 18 1 1 2342 420185603 420187932 0.000000e+00 4148.0
6 TraesCS7A01G098200 chr7B 99.317 2342 16 0 1 2342 716784508 716786849 0.000000e+00 4237.0
7 TraesCS7A01G098200 chr7B 99.231 2342 18 0 1 2342 742948837 742946496 0.000000e+00 4226.0
8 TraesCS7A01G098200 chr7B 96.317 2308 68 4 38 2342 139608300 139610593 0.000000e+00 3775.0
9 TraesCS7A01G098200 chr1D 98.112 2331 41 2 1 2329 275778829 275781158 0.000000e+00 4058.0
10 TraesCS7A01G098200 chr6B 97.139 2342 53 3 1 2342 388287136 388284809 0.000000e+00 3941.0
11 TraesCS7A01G098200 chr2D 96.116 2343 69 8 1 2342 291773520 291775841 0.000000e+00 3803.0


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS7A01G098200 chr7A 60166525 60168866 2341 True 4325 4325 100.000 1 2342 1 chr7A.!!$R1 2341
1 TraesCS7A01G098200 chr7A 60084837 60087178 2341 False 4231 4231 99.274 1 2342 1 chr7A.!!$F1 2341
2 TraesCS7A01G098200 chr5A 16544455 16546796 2341 False 4248 4248 99.402 1 2342 1 chr5A.!!$F1 2341
3 TraesCS7A01G098200 chr5A 420185603 420187932 2329 False 4148 4148 98.719 1 2342 1 chr5A.!!$F2 2341
4 TraesCS7A01G098200 chr7B 716784508 716786849 2341 False 4237 4237 99.317 1 2342 1 chr7B.!!$F2 2341
5 TraesCS7A01G098200 chr7B 742946496 742948837 2341 True 4226 4226 99.231 1 2342 1 chr7B.!!$R1 2341
6 TraesCS7A01G098200 chr7B 139608300 139610593 2293 False 3775 3775 96.317 38 2342 1 chr7B.!!$F1 2304
7 TraesCS7A01G098200 chr1D 275778829 275781158 2329 False 4058 4058 98.112 1 2329 1 chr1D.!!$F1 2328
8 TraesCS7A01G098200 chr6B 388284809 388287136 2327 True 3941 3941 97.139 1 2342 1 chr6B.!!$R1 2341
9 TraesCS7A01G098200 chr2D 291773520 291775841 2321 False 3803 3803 96.116 1 2342 1 chr2D.!!$F1 2341

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
91 92 0.961857 TAGCTCGACTGCGTTACCCA 60.962 55.000 0.0 0.0 38.98 4.51 F
487 488 1.945394 GCTTCTGTGATCGAATGCCAT 59.055 47.619 0.0 0.0 0.00 4.40 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1262 1263 1.745087 ACAATGCAATAGCTTCGGTGG 59.255 47.619 0.0 0.0 42.74 4.61 R
2001 2008 2.497675 TCTTTAGCTTGCTCCGACAGAT 59.502 45.455 0.0 0.0 0.00 2.90 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
91 92 0.961857 TAGCTCGACTGCGTTACCCA 60.962 55.000 0.00 0.0 38.98 4.51
487 488 1.945394 GCTTCTGTGATCGAATGCCAT 59.055 47.619 0.00 0.0 0.00 4.40
654 655 7.216494 ACCTGTGAATTAATCAAAAAGGTTGG 58.784 34.615 2.42 0.0 42.02 3.77
1262 1263 3.538379 CCATTTTGGGCTTTGCTCC 57.462 52.632 0.00 0.0 32.67 4.70
2001 2008 2.461695 CTGCTAAGGGAGAAGGAGACA 58.538 52.381 0.00 0.0 33.37 3.41
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
91 92 4.217118 GTCTCCAGCTTGTGTTTCAATCAT 59.783 41.667 0.0 0.0 35.35 2.45
654 655 1.269831 CCTACATCTGCGAGTAAGGGC 60.270 57.143 0.0 0.0 0.00 5.19
1262 1263 1.745087 ACAATGCAATAGCTTCGGTGG 59.255 47.619 0.0 0.0 42.74 4.61
2001 2008 2.497675 TCTTTAGCTTGCTCCGACAGAT 59.502 45.455 0.0 0.0 0.00 2.90


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.