Multiple sequence alignment - TraesCS7A01G098000

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS7A01G098000 chr7A 100.000 2255 0 0 1 2255 60150103 60147849 0 4165
1 TraesCS7A01G098000 chr7A 98.091 2253 42 1 3 2255 46399060 46396809 0 3921
2 TraesCS7A01G098000 chr7A 97.662 1711 39 1 545 2255 211276482 211274773 0 2937
3 TraesCS7A01G098000 chr1D 99.335 2255 14 1 1 2255 141314951 141312698 0 4080
4 TraesCS7A01G098000 chr7B 99.246 2256 16 1 1 2255 644465627 644467882 0 4071
5 TraesCS7A01G098000 chr3A 99.157 2255 19 0 1 2255 633109438 633111692 0 4060
6 TraesCS7A01G098000 chr1B 98.891 2255 25 0 1 2255 672477345 672479599 0 4026
7 TraesCS7A01G098000 chr1B 98.848 2256 24 2 1 2255 638702482 638700228 0 4021
8 TraesCS7A01G098000 chr6B 98.803 2255 27 0 1 2255 306997806 306995552 0 4015
9 TraesCS7A01G098000 chr2B 98.449 2256 29 3 1 2255 391114652 391112402 0 3967


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS7A01G098000 chr7A 60147849 60150103 2254 True 4165 4165 100.000 1 2255 1 chr7A.!!$R2 2254
1 TraesCS7A01G098000 chr7A 46396809 46399060 2251 True 3921 3921 98.091 3 2255 1 chr7A.!!$R1 2252
2 TraesCS7A01G098000 chr7A 211274773 211276482 1709 True 2937 2937 97.662 545 2255 1 chr7A.!!$R3 1710
3 TraesCS7A01G098000 chr1D 141312698 141314951 2253 True 4080 4080 99.335 1 2255 1 chr1D.!!$R1 2254
4 TraesCS7A01G098000 chr7B 644465627 644467882 2255 False 4071 4071 99.246 1 2255 1 chr7B.!!$F1 2254
5 TraesCS7A01G098000 chr3A 633109438 633111692 2254 False 4060 4060 99.157 1 2255 1 chr3A.!!$F1 2254
6 TraesCS7A01G098000 chr1B 672477345 672479599 2254 False 4026 4026 98.891 1 2255 1 chr1B.!!$F1 2254
7 TraesCS7A01G098000 chr1B 638700228 638702482 2254 True 4021 4021 98.848 1 2255 1 chr1B.!!$R1 2254
8 TraesCS7A01G098000 chr6B 306995552 306997806 2254 True 4015 4015 98.803 1 2255 1 chr6B.!!$R1 2254
9 TraesCS7A01G098000 chr2B 391112402 391114652 2250 True 3967 3967 98.449 1 2255 1 chr2B.!!$R1 2254

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
308 309 8.918202 TCTTCCTTCTAAACTAATTGCTTTCA 57.082 30.769 0.0 0.0 0.0 2.69 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2095 2104 3.440872 AGAACTACTGTGAGCGGTCTAAG 59.559 47.826 16.64 14.71 35.51 2.18 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
308 309 8.918202 TCTTCCTTCTAAACTAATTGCTTTCA 57.082 30.769 0.00 0.00 0.00 2.69
1379 1381 8.445493 GCTTTAGGTACGCTTTAGTTTGAAATA 58.555 33.333 0.00 0.00 0.00 1.40
1814 1820 0.815615 CCTATCGGCAAGGCTTGGAC 60.816 60.000 27.25 12.36 0.00 4.02
2030 2037 1.349357 GAGGGGCCCTGATCTATCAAC 59.651 57.143 34.51 7.43 36.18 3.18
2095 2104 3.403968 AGAAAGAAAGAAGGGTCGAAGC 58.596 45.455 0.00 0.00 0.00 3.86
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
1379 1381 5.844004 ACGAGGTCGAGCATATCTTTAATT 58.156 37.500 18.15 0.00 43.02 1.40
2095 2104 3.440872 AGAACTACTGTGAGCGGTCTAAG 59.559 47.826 16.64 14.71 35.51 2.18


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.