Multiple sequence alignment - TraesCS7A01G097900

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS7A01G097900 chr7A 100.000 2360 0 0 1 2360 60120927 60118568 0 4359
1 TraesCS7A01G097900 chr7A 98.602 2360 32 1 1 2360 63429290 63431648 0 4174
2 TraesCS7A01G097900 chr7A 98.347 2360 37 1 1 2360 211272569 211270212 0 4141
3 TraesCS7A01G097900 chr7B 99.280 2360 17 0 1 2360 644470082 644472441 0 4265
4 TraesCS7A01G097900 chr7D 99.237 2360 17 1 1 2360 203518117 203520475 0 4257
5 TraesCS7A01G097900 chr3A 98.729 2360 28 1 1 2360 633113889 633116246 0 4191
6 TraesCS7A01G097900 chr3A 98.136 2360 44 0 1 2360 51869813 51872172 0 4115
7 TraesCS7A01G097900 chr6B 98.559 2360 32 2 1 2360 306993349 306990992 0 4169


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS7A01G097900 chr7A 60118568 60120927 2359 True 4359 4359 100.000 1 2360 1 chr7A.!!$R1 2359
1 TraesCS7A01G097900 chr7A 63429290 63431648 2358 False 4174 4174 98.602 1 2360 1 chr7A.!!$F1 2359
2 TraesCS7A01G097900 chr7A 211270212 211272569 2357 True 4141 4141 98.347 1 2360 1 chr7A.!!$R2 2359
3 TraesCS7A01G097900 chr7B 644470082 644472441 2359 False 4265 4265 99.280 1 2360 1 chr7B.!!$F1 2359
4 TraesCS7A01G097900 chr7D 203518117 203520475 2358 False 4257 4257 99.237 1 2360 1 chr7D.!!$F1 2359
5 TraesCS7A01G097900 chr3A 633113889 633116246 2357 False 4191 4191 98.729 1 2360 1 chr3A.!!$F2 2359
6 TraesCS7A01G097900 chr3A 51869813 51872172 2359 False 4115 4115 98.136 1 2360 1 chr3A.!!$F1 2359
7 TraesCS7A01G097900 chr6B 306990992 306993349 2357 True 4169 4169 98.559 1 2360 1 chr6B.!!$R1 2359

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1078 1079 3.298686 AAAGGCCCTATGGAGTAAAGC 57.701 47.619 0.0 0.0 0.0 3.51 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2309 2312 2.895404 GGGGTTGGGAAAGTAAGGAAAC 59.105 50.0 0.0 0.0 0.0 2.78 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
1078 1079 3.298686 AAAGGCCCTATGGAGTAAAGC 57.701 47.619 0.00 0.0 0.00 3.51
1668 1671 3.072476 ACGGGGATGTCTCAAGAAGAAAA 59.928 43.478 0.00 0.0 35.21 2.29
1776 1779 0.983467 GGTACCGTACCCCAAGGAAA 59.017 55.000 15.95 0.0 43.18 3.13
1878 1881 4.581093 GCGGGAATACTGGGGGCC 62.581 72.222 0.00 0.0 0.00 5.80
2309 2312 1.938577 CACAGAATCATCGGGCTTGAG 59.061 52.381 0.00 0.0 0.00 3.02
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
473 474 3.537961 AAGGGGCGGGGCATTTTCA 62.538 57.895 0.00 0.0 0.00 2.69
1078 1079 0.158096 GTGACAACGTACACGCTTCG 59.842 55.000 0.85 0.0 44.43 3.79
1668 1671 1.777272 GGGAGGCTACCAATTCTGGAT 59.223 52.381 12.07 0.0 46.92 3.41
1776 1779 3.165087 TGGCGCAGTATAGTATACCCT 57.835 47.619 10.83 0.0 0.00 4.34
2309 2312 2.895404 GGGGTTGGGAAAGTAAGGAAAC 59.105 50.000 0.00 0.0 0.00 2.78


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.