Multiple sequence alignment - TraesCS7A01G097800

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS7A01G097800 chr7A 100.000 2793 0 0 1 2793 60106951 60104159 0 5158
1 TraesCS7A01G097800 chr7A 99.214 891 7 0 1903 2793 4936493 4935603 0 1607
2 TraesCS7A01G097800 chr5A 99.035 2798 22 3 1 2793 73031637 73034434 0 5012
3 TraesCS7A01G097800 chr1B 98.678 2799 31 3 1 2793 638749964 638747166 0 4959
4 TraesCS7A01G097800 chr2B 98.106 2798 48 4 1 2793 500714164 500716961 0 4868
5 TraesCS7A01G097800 chr2B 96.992 2793 78 5 4 2792 751970335 751967545 0 4687
6 TraesCS7A01G097800 chr2B 98.296 2347 33 6 452 2793 357761029 357758685 0 4106
7 TraesCS7A01G097800 chr6B 97.712 2797 59 4 1 2793 388367587 388364792 0 4806
8 TraesCS7A01G097800 chr6B 96.532 2797 84 7 1 2793 626863069 626865856 0 4615
9 TraesCS7A01G097800 chr6B 96.327 2287 79 3 1 2283 588839000 588841285 0 3753
10 TraesCS7A01G097800 chr3B 97.640 2797 62 3 1 2793 575754678 575751882 0 4796


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS7A01G097800 chr7A 60104159 60106951 2792 True 5158 5158 100.000 1 2793 1 chr7A.!!$R2 2792
1 TraesCS7A01G097800 chr7A 4935603 4936493 890 True 1607 1607 99.214 1903 2793 1 chr7A.!!$R1 890
2 TraesCS7A01G097800 chr5A 73031637 73034434 2797 False 5012 5012 99.035 1 2793 1 chr5A.!!$F1 2792
3 TraesCS7A01G097800 chr1B 638747166 638749964 2798 True 4959 4959 98.678 1 2793 1 chr1B.!!$R1 2792
4 TraesCS7A01G097800 chr2B 500714164 500716961 2797 False 4868 4868 98.106 1 2793 1 chr2B.!!$F1 2792
5 TraesCS7A01G097800 chr2B 751967545 751970335 2790 True 4687 4687 96.992 4 2792 1 chr2B.!!$R2 2788
6 TraesCS7A01G097800 chr2B 357758685 357761029 2344 True 4106 4106 98.296 452 2793 1 chr2B.!!$R1 2341
7 TraesCS7A01G097800 chr6B 388364792 388367587 2795 True 4806 4806 97.712 1 2793 1 chr6B.!!$R1 2792
8 TraesCS7A01G097800 chr6B 626863069 626865856 2787 False 4615 4615 96.532 1 2793 1 chr6B.!!$F2 2792
9 TraesCS7A01G097800 chr6B 588839000 588841285 2285 False 3753 3753 96.327 1 2283 1 chr6B.!!$F1 2282
10 TraesCS7A01G097800 chr3B 575751882 575754678 2796 True 4796 4796 97.640 1 2793 1 chr3B.!!$R1 2792

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
271 272 1.206371 CCGAGGTATTTTCACGGGTCT 59.794 52.381 0.0 0.0 39.92 3.85 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2231 2238 0.735978 CAATGACAGCGTACCGAGCA 60.736 55.0 0.0 0.0 37.01 4.26 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
77 78 5.347124 TGAGGGGGAAACTAAGTAAGATGA 58.653 41.667 0.00 0.00 0.00 2.92
271 272 1.206371 CCGAGGTATTTTCACGGGTCT 59.794 52.381 0.00 0.00 39.92 3.85
442 443 3.527665 AGCAAGGGTTGTAGGTCCATTAT 59.472 43.478 0.00 0.00 0.00 1.28
1275 1276 8.774546 ATGGTTCTATTCTCTTCATAGTCTCA 57.225 34.615 0.00 0.00 0.00 3.27
1464 1467 3.242011 TGGGCTCATCATGCTATACTCA 58.758 45.455 0.00 0.00 0.00 3.41
1627 1630 3.493176 GCAACTGGCTTTCATGGTTTTCT 60.493 43.478 0.00 0.00 40.25 2.52
1672 1675 2.288579 TGATCGTATGTGGTATTCGCCC 60.289 50.000 0.00 0.00 0.00 6.13
2231 2238 1.228490 CCCGATAGACGTAGGGCCT 60.228 63.158 12.58 12.58 40.78 5.19
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
77 78 2.865343 ATATTTCGTCGCTTCTCCGT 57.135 45.000 0.0 0.0 0.00 4.69
1275 1276 6.731292 AAAGCAAAAAGGAACATAACCTCT 57.269 33.333 0.0 0.0 36.67 3.69
1464 1467 0.887836 GCTCGTTTTTCCTTCCCCGT 60.888 55.000 0.0 0.0 0.00 5.28
2231 2238 0.735978 CAATGACAGCGTACCGAGCA 60.736 55.000 0.0 0.0 37.01 4.26
2724 2735 1.430992 AACCTCTGGACGAAAGGGAA 58.569 50.000 0.0 0.0 34.31 3.97


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.