Multiple sequence alignment - TraesCS7A01G097700

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS7A01G097700 chr7A 100.000 3161 0 0 1 3161 60098404 60095244 0 5838
1 TraesCS7A01G097700 chr1B 98.767 2270 19 3 1 2270 517083227 517085487 0 4028
2 TraesCS7A01G097700 chr1B 98.326 2270 29 3 1 2270 638741409 638739149 0 3973
3 TraesCS7A01G097700 chr1B 98.178 2250 39 2 912 3161 583549016 583551263 0 3927
4 TraesCS7A01G097700 chr1B 96.863 2263 53 9 912 3161 49816544 49818801 0 3770
5 TraesCS7A01G097700 chr6B 98.711 2250 28 1 912 3161 128891277 128889029 0 3993
6 TraesCS7A01G097700 chr6B 97.738 1061 18 2 1 1057 388359045 388357987 0 1821
7 TraesCS7A01G097700 chr6B 96.704 1062 24 6 1 1057 388166990 388165935 0 1757
8 TraesCS7A01G097700 chr6B 96.594 1057 30 2 2 1054 588904108 588905162 0 1748
9 TraesCS7A01G097700 chr5B 98.533 2250 31 2 912 3161 713114256 713112009 0 3971
10 TraesCS7A01G097700 chr5B 98.400 2250 35 1 912 3161 713094471 713096719 0 3954
11 TraesCS7A01G097700 chr7B 98.490 2251 32 2 912 3161 716797133 716794884 0 3967
12 TraesCS7A01G097700 chr7B 98.490 2251 31 2 911 3161 742936187 742938434 0 3965
13 TraesCS7A01G097700 chr7B 97.353 1058 22 2 1 1054 531994930 531995985 0 1794
14 TraesCS7A01G097700 chr2B 96.984 1061 26 2 1 1057 751961810 751960752 0 1777
15 TraesCS7A01G097700 chr3A 96.324 1061 32 3 1 1057 718994176 718993119 0 1736
16 TraesCS7A01G097700 chr6A 96.030 1058 35 3 4 1057 272161836 272160782 0 1714


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS7A01G097700 chr7A 60095244 60098404 3160 True 5838 5838 100.000 1 3161 1 chr7A.!!$R1 3160
1 TraesCS7A01G097700 chr1B 517083227 517085487 2260 False 4028 4028 98.767 1 2270 1 chr1B.!!$F2 2269
2 TraesCS7A01G097700 chr1B 638739149 638741409 2260 True 3973 3973 98.326 1 2270 1 chr1B.!!$R1 2269
3 TraesCS7A01G097700 chr1B 583549016 583551263 2247 False 3927 3927 98.178 912 3161 1 chr1B.!!$F3 2249
4 TraesCS7A01G097700 chr1B 49816544 49818801 2257 False 3770 3770 96.863 912 3161 1 chr1B.!!$F1 2249
5 TraesCS7A01G097700 chr6B 128889029 128891277 2248 True 3993 3993 98.711 912 3161 1 chr6B.!!$R1 2249
6 TraesCS7A01G097700 chr6B 388357987 388359045 1058 True 1821 1821 97.738 1 1057 1 chr6B.!!$R3 1056
7 TraesCS7A01G097700 chr6B 388165935 388166990 1055 True 1757 1757 96.704 1 1057 1 chr6B.!!$R2 1056
8 TraesCS7A01G097700 chr6B 588904108 588905162 1054 False 1748 1748 96.594 2 1054 1 chr6B.!!$F1 1052
9 TraesCS7A01G097700 chr5B 713112009 713114256 2247 True 3971 3971 98.533 912 3161 1 chr5B.!!$R1 2249
10 TraesCS7A01G097700 chr5B 713094471 713096719 2248 False 3954 3954 98.400 912 3161 1 chr5B.!!$F1 2249
11 TraesCS7A01G097700 chr7B 716794884 716797133 2249 True 3967 3967 98.490 912 3161 1 chr7B.!!$R1 2249
12 TraesCS7A01G097700 chr7B 742936187 742938434 2247 False 3965 3965 98.490 911 3161 1 chr7B.!!$F2 2250
13 TraesCS7A01G097700 chr7B 531994930 531995985 1055 False 1794 1794 97.353 1 1054 1 chr7B.!!$F1 1053
14 TraesCS7A01G097700 chr2B 751960752 751961810 1058 True 1777 1777 96.984 1 1057 1 chr2B.!!$R1 1056
15 TraesCS7A01G097700 chr3A 718993119 718994176 1057 True 1736 1736 96.324 1 1057 1 chr3A.!!$R1 1056
16 TraesCS7A01G097700 chr6A 272160782 272161836 1054 True 1714 1714 96.030 4 1057 1 chr6A.!!$R1 1053

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
687 691 0.680921 ACCGCCTACCTACGCTAACA 60.681 55.0 0.0 0.0 0.00 2.41 F
1267 1281 5.643777 GGAGCAGTCAATTTAGCTAGAACAA 59.356 40.0 0.0 0.0 37.48 2.83 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1599 1616 4.324267 CGGAAAGACCACCTATTTGTTCT 58.676 43.478 0.00 0.00 38.90 3.01 R
2818 2837 5.826312 AGGGGGCCTACTATATGTATACA 57.174 43.478 8.27 8.27 28.47 2.29 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
687 691 0.680921 ACCGCCTACCTACGCTAACA 60.681 55.000 0.00 0.00 0.00 2.41
1036 1049 9.929180 TTTCTACGGATATGAAGGATAGAAATG 57.071 33.333 0.00 0.00 34.11 2.32
1267 1281 5.643777 GGAGCAGTCAATTTAGCTAGAACAA 59.356 40.000 0.00 0.00 37.48 2.83
1599 1616 2.623878 TCGTGCTGAACCTGGTAAAA 57.376 45.000 0.00 0.00 0.00 1.52
1651 1668 2.485266 ACAAAAGTTTTTCCCTCGCG 57.515 45.000 0.00 0.00 0.00 5.87
1806 1823 4.161001 GGATTTCAAAGACATGGGCTTCAT 59.839 41.667 0.00 0.00 36.31 2.57
2026 2044 2.977808 TCATAGGAGATCTTGGTCCCC 58.022 52.381 0.00 0.00 32.70 4.81
2081 2099 8.585881 GGAATTAGGTGTAGCTATATCACAAGA 58.414 37.037 13.24 1.38 34.27 3.02
2551 2570 2.480416 GGAGAACGAGCAGACATCGAAT 60.480 50.000 1.94 0.00 42.76 3.34
2818 2837 5.730550 TGTCTTGAACCGCTTACTAATCAT 58.269 37.500 0.00 0.00 0.00 2.45
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
572 576 1.067516 GCAGCAGAGTTTGAGGCAAAA 59.932 47.619 0.00 0.00 35.03 2.44
687 691 3.769739 TCCGCCATCTGCATTAGTTAT 57.230 42.857 0.00 0.00 41.33 1.89
1223 1237 2.552155 CCCTGTTCGGACTCATTTTGGA 60.552 50.000 0.00 0.00 33.16 3.53
1267 1281 2.515901 GTGGCGGGCTCCCAATAT 59.484 61.111 5.70 0.00 33.39 1.28
1599 1616 4.324267 CGGAAAGACCACCTATTTGTTCT 58.676 43.478 0.00 0.00 38.90 3.01
1651 1668 5.006068 ACGAAAAAGTAAAAGTGACCGAGAC 59.994 40.000 0.00 0.00 0.00 3.36
2026 2044 9.924650 ACCGGTTAATGCTAGAACTATAAATAG 57.075 33.333 0.00 0.00 36.46 1.73
2081 2099 8.498054 ACAAATTGAGATCGTAGAAACATGAT 57.502 30.769 0.00 0.00 43.58 2.45
2152 2170 7.066525 TCGGCTCCTCGTTTTTATTCAATTATT 59.933 33.333 0.00 0.00 0.00 1.40
2818 2837 5.826312 AGGGGGCCTACTATATGTATACA 57.174 43.478 8.27 8.27 28.47 2.29


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.