Multiple sequence alignment - TraesCS7A01G097600

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS7A01G097600 chr7A 100.000 2519 0 0 1 2519 60096175 60093657 0 4652
1 TraesCS7A01G097600 chr7B 99.166 2519 20 1 1 2519 698126910 698124393 0 4534
2 TraesCS7A01G097600 chr7B 98.769 2519 31 0 1 2519 716795815 716793297 0 4481
3 TraesCS7A01G097600 chr7B 98.690 2519 29 2 1 2519 742937505 742940019 0 4466
4 TraesCS7A01G097600 chrUn 99.127 2519 21 1 1 2519 233525244 233522727 0 4529
5 TraesCS7A01G097600 chrUn 98.970 2524 20 2 1 2519 257944136 257946658 0 4512
6 TraesCS7A01G097600 chr1D 98.811 2524 25 1 1 2519 212428892 212431415 0 4490
7 TraesCS7A01G097600 chr2D 98.653 2524 27 3 1 2519 637308682 637306161 0 4466
8 TraesCS7A01G097600 chr6B 98.650 2519 34 0 1 2519 128889960 128887442 0 4464
9 TraesCS7A01G097600 chr5B 98.611 2519 34 1 1 2519 713112939 713110422 0 4457


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS7A01G097600 chr7A 60093657 60096175 2518 True 4652 4652 100.000 1 2519 1 chr7A.!!$R1 2518
1 TraesCS7A01G097600 chr7B 698124393 698126910 2517 True 4534 4534 99.166 1 2519 1 chr7B.!!$R1 2518
2 TraesCS7A01G097600 chr7B 716793297 716795815 2518 True 4481 4481 98.769 1 2519 1 chr7B.!!$R2 2518
3 TraesCS7A01G097600 chr7B 742937505 742940019 2514 False 4466 4466 98.690 1 2519 1 chr7B.!!$F1 2518
4 TraesCS7A01G097600 chrUn 233522727 233525244 2517 True 4529 4529 99.127 1 2519 1 chrUn.!!$R1 2518
5 TraesCS7A01G097600 chrUn 257944136 257946658 2522 False 4512 4512 98.970 1 2519 1 chrUn.!!$F1 2518
6 TraesCS7A01G097600 chr1D 212428892 212431415 2523 False 4490 4490 98.811 1 2519 1 chr1D.!!$F1 2518
7 TraesCS7A01G097600 chr2D 637306161 637308682 2521 True 4466 4466 98.653 1 2519 1 chr2D.!!$R1 2518
8 TraesCS7A01G097600 chr6B 128887442 128889960 2518 True 4464 4464 98.650 1 2519 1 chr6B.!!$R1 2518
9 TraesCS7A01G097600 chr5B 713110422 713112939 2517 True 4457 4457 98.611 1 2519 1 chr5B.!!$R1 2518

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
961 968 2.229543 TGCCTGCTTCAATTGATGTGAC 59.77 45.455 19.25 9.7 0.0 3.67 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2499 2506 0.251653 TTGGTGAGGAGCTACGGTCT 60.252 55.0 0.0 0.0 0.0 3.85 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
322 324 2.480416 GGAGAACGAGCAGACATCGAAT 60.480 50.000 1.94 0.00 42.76 3.34
596 598 7.718525 TGAACCGCTTACTAATCATGTATACA 58.281 34.615 8.27 8.27 0.00 2.29
961 968 2.229543 TGCCTGCTTCAATTGATGTGAC 59.770 45.455 19.25 9.70 0.00 3.67
1714 1721 2.090524 CACCGGCCTAAACGACGAC 61.091 63.158 0.00 0.00 0.00 4.34
1815 1822 2.156917 CATGCTTTCAGAGAAGTGGCA 58.843 47.619 0.00 0.00 0.00 4.92
2442 2449 3.446570 GGCTCAGCCCACATGCAC 61.447 66.667 3.37 0.00 44.06 4.57
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
596 598 1.569653 GCGAAGGGGGCCTACTATAT 58.430 55.000 0.84 0.0 31.13 0.86
1136 1143 8.171337 ACCCCTATAAAAATCTAGTGGAAGTT 57.829 34.615 0.00 0.0 0.00 2.66
1714 1721 1.787155 CTCTCACGTTCGAGTGTTTGG 59.213 52.381 4.89 0.0 42.40 3.28
1815 1822 1.924731 TGTCAGAGTGGATTCGGACT 58.075 50.000 7.57 0.0 41.14 3.85
2442 2449 3.508793 ACTGGAGTGCTTTCATCAAATGG 59.491 43.478 0.00 0.0 0.00 3.16
2499 2506 0.251653 TTGGTGAGGAGCTACGGTCT 60.252 55.000 0.00 0.0 0.00 3.85


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.