Multiple sequence alignment - TraesCS7A01G082600

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS7A01G082600 chr7A 100.000 2605 0 0 1 2605 47574456 47571852 0.000000e+00 4811.0
1 TraesCS7A01G082600 chr7A 99.347 2605 15 1 1 2605 47608874 47606272 0.000000e+00 4715.0
2 TraesCS7A01G082600 chr7A 99.044 2614 15 2 1 2605 47588598 47585986 0.000000e+00 4680.0
3 TraesCS7A01G082600 chrUn 99.158 2614 12 2 1 2605 317692132 317694744 0.000000e+00 4697.0
4 TraesCS7A01G082600 chrUn 99.465 1868 10 0 1 1868 264366068 264364201 0.000000e+00 3395.0
5 TraesCS7A01G082600 chrUn 99.538 1300 4 1 1303 2602 414618909 414620206 0.000000e+00 2366.0
6 TraesCS7A01G082600 chrUn 99.309 1303 6 1 1303 2605 362060464 362061763 0.000000e+00 2353.0
7 TraesCS7A01G082600 chrUn 99.308 1301 9 0 1 1301 399199736 399201036 0.000000e+00 2353.0
8 TraesCS7A01G082600 chrUn 99.585 723 3 0 1 723 370957006 370957728 0.000000e+00 1319.0
9 TraesCS7A01G082600 chr7D 91.199 1534 115 10 104 1626 45514228 45512704 0.000000e+00 2067.0
10 TraesCS7A01G082600 chr7D 89.140 442 26 12 2049 2473 45512147 45511711 4.940000e-147 531.0
11 TraesCS7A01G082600 chr7D 78.154 325 48 17 1628 1937 45512758 45512442 4.430000e-43 185.0
12 TraesCS7A01G082600 chr7D 79.562 274 24 14 1687 1952 45512411 45512162 1.600000e-37 167.0
13 TraesCS7A01G082600 chr7D 100.000 31 0 0 1951 1981 45512174 45512144 1.010000e-04 58.4
14 TraesCS7A01G082600 chr4A 87.889 1544 156 21 100 1626 658824452 658825981 0.000000e+00 1786.0
15 TraesCS7A01G082600 chr4A 87.146 1517 167 20 104 1613 657500905 657499410 0.000000e+00 1696.0
16 TraesCS7A01G082600 chr4A 85.065 308 30 7 1625 1923 657499452 657499152 1.520000e-77 300.0
17 TraesCS7A01G082600 chr4A 87.151 179 8 6 2138 2302 657499147 657498970 3.420000e-44 189.0
18 TraesCS7A01G082600 chr4A 86.111 180 9 7 2138 2302 658826565 658826743 2.060000e-41 180.0
19 TraesCS7A01G082600 chr4A 88.393 112 7 4 1818 1923 658826449 658826560 2.100000e-26 130.0


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS7A01G082600 chr7A 47571852 47574456 2604 True 4811.000000 4811 100.000000 1 2605 1 chr7A.!!$R1 2604
1 TraesCS7A01G082600 chr7A 47606272 47608874 2602 True 4715.000000 4715 99.347000 1 2605 1 chr7A.!!$R3 2604
2 TraesCS7A01G082600 chr7A 47585986 47588598 2612 True 4680.000000 4680 99.044000 1 2605 1 chr7A.!!$R2 2604
3 TraesCS7A01G082600 chrUn 317692132 317694744 2612 False 4697.000000 4697 99.158000 1 2605 1 chrUn.!!$F1 2604
4 TraesCS7A01G082600 chrUn 264364201 264366068 1867 True 3395.000000 3395 99.465000 1 1868 1 chrUn.!!$R1 1867
5 TraesCS7A01G082600 chrUn 414618909 414620206 1297 False 2366.000000 2366 99.538000 1303 2602 1 chrUn.!!$F5 1299
6 TraesCS7A01G082600 chrUn 362060464 362061763 1299 False 2353.000000 2353 99.309000 1303 2605 1 chrUn.!!$F2 1302
7 TraesCS7A01G082600 chrUn 399199736 399201036 1300 False 2353.000000 2353 99.308000 1 1301 1 chrUn.!!$F4 1300
8 TraesCS7A01G082600 chrUn 370957006 370957728 722 False 1319.000000 1319 99.585000 1 723 1 chrUn.!!$F3 722
9 TraesCS7A01G082600 chr7D 45511711 45514228 2517 True 601.680000 2067 87.611000 104 2473 5 chr7D.!!$R1 2369
10 TraesCS7A01G082600 chr4A 657498970 657500905 1935 True 728.333333 1696 86.454000 104 2302 3 chr4A.!!$R1 2198
11 TraesCS7A01G082600 chr4A 658824452 658826743 2291 False 698.666667 1786 87.464333 100 2302 3 chr4A.!!$F1 2202

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
757 761 1.138266 GCGGGGTTATAGCTGTCAAGA 59.862 52.381 0.0 0.0 0.0 3.02 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2416 2768 1.067821 GGCGAGGAATCGACAGAATCT 59.932 52.381 1.17 0.0 41.52 2.4 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
757 761 1.138266 GCGGGGTTATAGCTGTCAAGA 59.862 52.381 0.0 0.0 0.0 3.02
2416 2768 4.588951 ACAGCATAGGATATTTCACGGAGA 59.411 41.667 0.0 0.0 0.0 3.71
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
757 761 8.041323 CAGTTCACCACTACTAGACCATATTTT 58.959 37.037 0.00 0.00 32.76 1.82
884 888 5.416013 TCGTATATGAGGAGCTTCGATTCAT 59.584 40.000 1.23 1.23 33.44 2.57
2119 2453 3.480470 CATCCAACACAGAAAGACACCT 58.520 45.455 0.00 0.00 0.00 4.00
2416 2768 1.067821 GGCGAGGAATCGACAGAATCT 59.932 52.381 1.17 0.00 41.52 2.40


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.