Multiple sequence alignment - TraesCS7A01G079100

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS7A01G079100 chr7A 100.000 2908 0 0 1 2908 44511557 44508650 0.000000e+00 5371.0
1 TraesCS7A01G079100 chr7A 99.001 2903 10 5 18 2908 44362989 44360094 0.000000e+00 5182.0
2 TraesCS7A01G079100 chr7A 97.826 46 1 0 40 85 44363011 44362966 2.400000e-11 80.5
3 TraesCS7A01G079100 chrUn 100.000 435 0 0 613 1047 476137334 476136900 0.000000e+00 804.0
4 TraesCS7A01G079100 chr2A 86.534 453 44 6 301 737 73550830 73550379 1.570000e-132 483.0
5 TraesCS7A01G079100 chr2A 85.901 383 33 8 2428 2792 733032947 733033326 3.510000e-104 388.0
6 TraesCS7A01G079100 chr3A 85.504 407 49 6 2387 2791 13404201 13403803 1.610000e-112 416.0
7 TraesCS7A01G079100 chr3A 78.209 592 92 25 129 690 31684720 31685304 7.720000e-91 344.0
8 TraesCS7A01G079100 chr3D 79.483 619 94 19 129 717 22078786 22079401 2.700000e-110 409.0
9 TraesCS7A01G079100 chr3B 79.500 600 87 21 152 720 38981168 38981762 7.550000e-106 394.0
10 TraesCS7A01G079100 chr1B 85.950 363 36 7 2436 2786 601829796 601829437 9.840000e-100 374.0
11 TraesCS7A01G079100 chr2D 84.123 359 38 10 337 677 74157321 74156964 2.160000e-86 329.0
12 TraesCS7A01G079100 chr2D 93.548 62 4 0 676 737 74156879 74156818 3.090000e-15 93.5
13 TraesCS7A01G079100 chr5A 91.000 200 18 0 765 964 198141315 198141514 1.330000e-68 270.0
14 TraesCS7A01G079100 chr5A 87.288 236 18 6 460 690 592275101 592274873 2.870000e-65 259.0
15 TraesCS7A01G079100 chr4A 94.059 101 6 0 2286 2386 652850845 652850745 1.400000e-33 154.0
16 TraesCS7A01G079100 chr4A 86.275 102 12 2 765 864 741023984 741023883 3.060000e-20 110.0
17 TraesCS7A01G079100 chr2B 88.636 88 7 3 2821 2908 316879377 316879293 1.430000e-18 104.0


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS7A01G079100 chr7A 44508650 44511557 2907 True 5371.00 5371 100.0000 1 2908 1 chr7A.!!$R1 2907
1 TraesCS7A01G079100 chr7A 44360094 44363011 2917 True 2631.25 5182 98.4135 18 2908 2 chr7A.!!$R2 2890
2 TraesCS7A01G079100 chr3A 31684720 31685304 584 False 344.00 344 78.2090 129 690 1 chr3A.!!$F1 561
3 TraesCS7A01G079100 chr3D 22078786 22079401 615 False 409.00 409 79.4830 129 717 1 chr3D.!!$F1 588
4 TraesCS7A01G079100 chr3B 38981168 38981762 594 False 394.00 394 79.5000 152 720 1 chr3B.!!$F1 568
5 TraesCS7A01G079100 chr2D 74156818 74157321 503 True 211.25 329 88.8355 337 737 2 chr2D.!!$R1 400

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
271 278 2.591715 CATTCATCCGTCCCGCCC 60.592 66.667 0.0 0.0 0.0 6.13 F
1047 1192 4.745172 GCAAGACCTCAGAGATATTTCCCC 60.745 50.000 0.0 0.0 0.0 4.81 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1201 1346 0.972134 CAGACCTCTTGAGACCAGCA 59.028 55.000 0.0 0.0 0.0 4.41 R
2528 2685 1.132495 AGGTATCCCACAGGTATCCCC 60.132 57.143 0.0 0.0 0.0 4.81 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
271 278 2.591715 CATTCATCCGTCCCGCCC 60.592 66.667 0.0 0.0 0.00 6.13
611 666 7.179269 ACTGTAAAGGGAATATGGCTTGTTTA 58.821 34.615 0.0 0.0 0.00 2.01
1047 1192 4.745172 GCAAGACCTCAGAGATATTTCCCC 60.745 50.000 0.0 0.0 0.00 4.81
1200 1345 7.592903 CCTGTCTTTCTATTTCTTTTTGCAGAC 59.407 37.037 0.0 0.0 0.00 3.51
1201 1346 8.225603 TGTCTTTCTATTTCTTTTTGCAGACT 57.774 30.769 0.0 0.0 0.00 3.24
1202 1347 8.131100 TGTCTTTCTATTTCTTTTTGCAGACTG 58.869 33.333 0.0 0.0 0.00 3.51
2091 2248 7.154435 TCGAGTTAGTACTTTGAGCATACTT 57.846 36.000 0.0 0.0 33.84 2.24
2092 2249 7.600065 TCGAGTTAGTACTTTGAGCATACTTT 58.400 34.615 0.0 0.0 33.84 2.66
2106 2263 7.950512 TGAGCATACTTTCTCATTTCCAAAAA 58.049 30.769 0.0 0.0 34.69 1.94
2354 2511 5.540911 CAAGCCTTGTCACCATGTAAAATT 58.459 37.500 0.0 0.0 0.00 1.82
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
0 1 0.109132 CCGAAGGCCATTTTGTCTGC 60.109 55.000 5.01 0.00 46.14 4.26
14 15 2.095059 CAGTCATTTTCTTGGGCCGAAG 60.095 50.000 20.71 20.71 0.00 3.79
15 16 1.885887 CAGTCATTTTCTTGGGCCGAA 59.114 47.619 0.00 0.00 0.00 4.30
17 18 0.527565 CCAGTCATTTTCTTGGGCCG 59.472 55.000 0.00 0.00 0.00 6.13
20 21 1.812571 CGGACCAGTCATTTTCTTGGG 59.187 52.381 0.00 0.00 0.00 4.12
1047 1192 7.881751 ATATGGTCATATGTCAGACAAATCTGG 59.118 37.037 7.50 0.00 41.15 3.86
1077 1222 3.491447 GGCCATGAAACTTCACCATATGC 60.491 47.826 0.00 0.00 40.49 3.14
1200 1345 1.067000 CAGACCTCTTGAGACCAGCAG 60.067 57.143 0.00 0.00 0.00 4.24
1201 1346 0.972134 CAGACCTCTTGAGACCAGCA 59.028 55.000 0.00 0.00 0.00 4.41
1202 1347 1.261480 TCAGACCTCTTGAGACCAGC 58.739 55.000 0.00 0.00 0.00 4.85
1420 1565 4.216257 CACCACTCCTACATGGAAAAACAG 59.784 45.833 0.00 0.00 45.63 3.16
2372 2529 6.592607 CGGTTAACTTAGCTTGTAGGATTCAA 59.407 38.462 5.42 0.00 0.00 2.69
2431 2588 6.628185 AGTATCAAAACGTATCCGAGTTTCT 58.372 36.000 0.00 0.00 39.36 2.52
2519 2676 3.716872 CCACAGGTATCCCCAAAGTATCT 59.283 47.826 0.00 0.00 34.66 1.98
2528 2685 1.132495 AGGTATCCCACAGGTATCCCC 60.132 57.143 0.00 0.00 0.00 4.81


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.