Multiple sequence alignment - TraesCS7A01G076300

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS7A01G076300 chr7A 100.000 3649 0 0 1 3649 41774560 41778208 0.000000e+00 6739
1 TraesCS7A01G076300 chr7A 98.767 3649 41 4 1 3649 41746056 41749700 0.000000e+00 6486
2 TraesCS7A01G076300 chr7A 98.191 3649 62 3 1 3649 41715620 41719264 0.000000e+00 6370
3 TraesCS7A01G076300 chr7A 91.584 2626 200 15 605 3216 41619328 41621946 0.000000e+00 3605
4 TraesCS7A01G076300 chr7D 94.723 2748 118 18 623 3364 42427393 42430119 0.000000e+00 4246
5 TraesCS7A01G076300 chr7D 94.360 1897 84 13 1472 3364 42423246 42425123 0.000000e+00 2889
6 TraesCS7A01G076300 chr4A 94.310 2777 143 13 599 3364 649184241 649187013 0.000000e+00 4239
7 TraesCS7A01G076300 chr4A 91.915 2585 180 13 646 3216 649007210 649009779 0.000000e+00 3589
8 TraesCS7A01G076300 chr4A 91.321 2581 204 12 646 3213 649056886 649059459 0.000000e+00 3507
9 TraesCS7A01G076300 chr4A 88.163 245 24 4 3408 3649 649155502 649155744 1.660000e-73 287
10 TraesCS7A01G076300 chrUn 94.234 2775 139 13 599 3364 250935573 250932811 0.000000e+00 4218
11 TraesCS7A01G076300 chrUn 93.138 1093 58 11 2278 3364 283089902 283090983 0.000000e+00 1587
12 TraesCS7A01G076300 chrUn 89.879 247 18 6 3409 3649 250932344 250932099 9.840000e-81 311
13 TraesCS7A01G076300 chrUn 89.879 247 18 6 3409 3649 387611557 387611802 9.840000e-81 311
14 TraesCS7A01G076300 chrUn 89.879 247 18 6 3409 3649 387613237 387613482 9.840000e-81 311
15 TraesCS7A01G076300 chrUn 89.516 248 18 6 3409 3649 370048454 370048208 1.270000e-79 307
16 TraesCS7A01G076300 chrUn 89.474 247 19 6 3409 3649 283091449 283091694 4.580000e-79 305
17 TraesCS7A01G076300 chr2B 92.837 2541 170 11 604 3136 783889047 783886511 0.000000e+00 3674
18 TraesCS7A01G076300 chr2B 94.693 603 29 3 1 601 64769986 64769385 0.000000e+00 933
19 TraesCS7A01G076300 chr5B 94.821 560 27 2 1 559 436803110 436802552 0.000000e+00 872
20 TraesCS7A01G076300 chr5B 89.684 601 46 5 1 600 611948487 611949072 0.000000e+00 752
21 TraesCS7A01G076300 chr5D 90.726 248 16 5 3408 3649 25039225 25038979 1.260000e-84 324


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS7A01G076300 chr7A 41774560 41778208 3648 False 6739.0 6739 100.0000 1 3649 1 chr7A.!!$F4 3648
1 TraesCS7A01G076300 chr7A 41746056 41749700 3644 False 6486.0 6486 98.7670 1 3649 1 chr7A.!!$F3 3648
2 TraesCS7A01G076300 chr7A 41715620 41719264 3644 False 6370.0 6370 98.1910 1 3649 1 chr7A.!!$F2 3648
3 TraesCS7A01G076300 chr7A 41619328 41621946 2618 False 3605.0 3605 91.5840 605 3216 1 chr7A.!!$F1 2611
4 TraesCS7A01G076300 chr7D 42423246 42430119 6873 False 3567.5 4246 94.5415 623 3364 2 chr7D.!!$F1 2741
5 TraesCS7A01G076300 chr4A 649184241 649187013 2772 False 4239.0 4239 94.3100 599 3364 1 chr4A.!!$F4 2765
6 TraesCS7A01G076300 chr4A 649007210 649009779 2569 False 3589.0 3589 91.9150 646 3216 1 chr4A.!!$F1 2570
7 TraesCS7A01G076300 chr4A 649056886 649059459 2573 False 3507.0 3507 91.3210 646 3213 1 chr4A.!!$F2 2567
8 TraesCS7A01G076300 chrUn 250932099 250935573 3474 True 2264.5 4218 92.0565 599 3649 2 chrUn.!!$R2 3050
9 TraesCS7A01G076300 chrUn 283089902 283091694 1792 False 946.0 1587 91.3060 2278 3649 2 chrUn.!!$F1 1371
10 TraesCS7A01G076300 chrUn 387611557 387613482 1925 False 311.0 311 89.8790 3409 3649 2 chrUn.!!$F2 240
11 TraesCS7A01G076300 chr2B 783886511 783889047 2536 True 3674.0 3674 92.8370 604 3136 1 chr2B.!!$R2 2532
12 TraesCS7A01G076300 chr2B 64769385 64769986 601 True 933.0 933 94.6930 1 601 1 chr2B.!!$R1 600
13 TraesCS7A01G076300 chr5B 436802552 436803110 558 True 872.0 872 94.8210 1 559 1 chr5B.!!$R1 558
14 TraesCS7A01G076300 chr5B 611948487 611949072 585 False 752.0 752 89.6840 1 600 1 chr5B.!!$F1 599

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
29 31 9.840427 AATAGTTCAAATAAAATCCAGACAACG 57.160 29.630 0.0 0.0 0.0 4.10 F
1031 4565 2.566913 TGTAGTGTTGATTGTTGGCGT 58.433 42.857 0.0 0.0 0.0 5.68 F
1494 5028 2.600731 CACTCCTCAAGCTACAAGTCG 58.399 52.381 0.0 0.0 0.0 4.18 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1494 5028 0.324943 TGCCAGAGTAGTTCTTGCCC 59.675 55.000 0.00 0.0 42.42 5.36 R
2276 5824 6.801539 TGAAATTCAACTATATCGCCCATC 57.198 37.500 0.00 0.0 0.00 3.51 R
3031 6589 1.490490 TCCCTGGCACATATGAACCTC 59.510 52.381 10.38 0.0 38.20 3.85 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
29 31 9.840427 AATAGTTCAAATAAAATCCAGACAACG 57.160 29.630 0.00 0.00 0.00 4.10
1031 4565 2.566913 TGTAGTGTTGATTGTTGGCGT 58.433 42.857 0.00 0.00 0.00 5.68
1127 4661 4.306471 CAACGCGTCGCTTTGGCA 62.306 61.111 24.27 0.00 34.79 4.92
1494 5028 2.600731 CACTCCTCAAGCTACAAGTCG 58.399 52.381 0.00 0.00 0.00 4.18
2276 5824 4.696479 ACAGGGGAGCATTAGTAAGATG 57.304 45.455 0.00 0.00 0.00 2.90
2454 6006 8.928448 TGTCAAATCTCCTAACAAGCTCTATAT 58.072 33.333 0.00 0.00 0.00 0.86
2635 6188 4.141959 TGACATCAAATCAGTGATAGGCGA 60.142 41.667 5.94 1.37 36.04 5.54
2744 6297 2.828520 GAGATCCGATGATGGGCTAAGA 59.171 50.000 0.00 0.00 0.00 2.10
3319 6961 0.529773 TGTGCAACGTGGACACTCTC 60.530 55.000 15.42 0.00 43.78 3.20
3627 8690 8.934507 TCCGTGAACTTTATTTCAAAATTTGT 57.065 26.923 5.56 0.00 37.24 2.83
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
29 31 0.249398 AATCACAGCCCGTAGTCACC 59.751 55.000 0.00 0.00 0.00 4.02
888 4418 9.481340 GCATATATGGGCATATATATACCGATG 57.519 37.037 16.11 13.08 42.20 3.84
890 4420 8.602472 TGCATATATGGGCATATATATACCGA 57.398 34.615 14.51 2.91 42.20 4.69
1127 4661 2.202703 GATCGTAGGCGCGGTTGT 60.203 61.111 8.83 0.00 38.14 3.32
1494 5028 0.324943 TGCCAGAGTAGTTCTTGCCC 59.675 55.000 0.00 0.00 42.42 5.36
2276 5824 6.801539 TGAAATTCAACTATATCGCCCATC 57.198 37.500 0.00 0.00 0.00 3.51
3031 6589 1.490490 TCCCTGGCACATATGAACCTC 59.510 52.381 10.38 0.00 38.20 3.85
3319 6961 4.141620 CCCCAATCCTCCTATATCCAATCG 60.142 50.000 0.00 0.00 0.00 3.34
3400 7042 6.540438 AATCTGGAAAAGTTCATGCATGAT 57.460 33.333 29.13 14.70 36.56 2.45


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.