Multiple sequence alignment - TraesCS7A01G059400

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS7A01G059400 chr7A 100.000 2306 0 0 1 2306 28968805 28966500 0.000000e+00 4259
1 TraesCS7A01G059400 chr7A 98.482 2306 23 2 1 2306 29009024 29006731 0.000000e+00 4054
2 TraesCS7A01G059400 chr7A 98.621 2031 27 1 1 2030 28845509 28843479 0.000000e+00 3594
3 TraesCS7A01G059400 chr7A 98.523 2031 29 1 1 2030 28808708 28806678 0.000000e+00 3583
4 TraesCS7A01G059400 chr7A 98.061 2011 19 1 1 2011 28915373 28913383 0.000000e+00 3480
5 TraesCS7A01G059400 chr7A 98.052 154 3 0 2153 2306 28913384 28913231 3.780000e-68 268
6 TraesCS7A01G059400 chr7A 98.230 113 2 0 2194 2306 28806681 28806569 5.030000e-47 198
7 TraesCS7A01G059400 chr7A 98.230 113 2 0 2194 2306 28843482 28843370 5.030000e-47 198
8 TraesCS7A01G059400 chrUn 98.396 2307 30 4 1 2306 313533153 313530853 0.000000e+00 4048
9 TraesCS7A01G059400 chrUn 90.428 1494 127 9 1 1494 381415726 381414249 0.000000e+00 1953
10 TraesCS7A01G059400 chrUn 83.154 279 24 13 1489 1767 459694204 459694459 1.380000e-57 233
11 TraesCS7A01G059400 chr4A 94.904 1668 74 4 1 1659 702327577 702325912 0.000000e+00 2599
12 TraesCS7A01G059400 chr4A 87.492 1663 187 12 1 1651 702298577 702296924 0.000000e+00 1899
13 TraesCS7A01G059400 chr4A 89.344 244 22 3 2065 2306 702321172 702320931 1.040000e-78 303
14 TraesCS7A01G059400 chr4A 82.156 269 25 14 2049 2306 702349035 702348779 2.320000e-50 209
15 TraesCS7A01G059400 chr4A 90.789 76 7 0 1960 2035 702317735 702317660 4.050000e-18 102
16 TraesCS7A01G059400 chr7D 88.479 1788 170 21 1 1770 28578342 28576573 0.000000e+00 2128
17 TraesCS7A01G059400 chr7D 83.920 199 24 5 2108 2306 28542838 28542648 1.410000e-42 183
18 TraesCS7A01G059400 chr7D 83.893 149 12 5 2049 2190 28575769 28575626 5.170000e-27 132


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS7A01G059400 chr7A 28966500 28968805 2305 True 4259.0 4259 100.0000 1 2306 1 chr7A.!!$R1 2305
1 TraesCS7A01G059400 chr7A 29006731 29009024 2293 True 4054.0 4054 98.4820 1 2306 1 chr7A.!!$R2 2305
2 TraesCS7A01G059400 chr7A 28843370 28845509 2139 True 1896.0 3594 98.4255 1 2306 2 chr7A.!!$R4 2305
3 TraesCS7A01G059400 chr7A 28806569 28808708 2139 True 1890.5 3583 98.3765 1 2306 2 chr7A.!!$R3 2305
4 TraesCS7A01G059400 chr7A 28913231 28915373 2142 True 1874.0 3480 98.0565 1 2306 2 chr7A.!!$R5 2305
5 TraesCS7A01G059400 chrUn 313530853 313533153 2300 True 4048.0 4048 98.3960 1 2306 1 chrUn.!!$R1 2305
6 TraesCS7A01G059400 chrUn 381414249 381415726 1477 True 1953.0 1953 90.4280 1 1494 1 chrUn.!!$R2 1493
7 TraesCS7A01G059400 chr4A 702325912 702327577 1665 True 2599.0 2599 94.9040 1 1659 1 chr4A.!!$R2 1658
8 TraesCS7A01G059400 chr4A 702296924 702298577 1653 True 1899.0 1899 87.4920 1 1651 1 chr4A.!!$R1 1650
9 TraesCS7A01G059400 chr4A 702317660 702321172 3512 True 202.5 303 90.0665 1960 2306 2 chr4A.!!$R4 346
10 TraesCS7A01G059400 chr7D 28575626 28578342 2716 True 1130.0 2128 86.1860 1 2190 2 chr7D.!!$R2 2189

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
811 820 0.170561 GTACGTCCGTGATGCTCACT 59.829 55.0 1.98 0.0 44.85 3.41 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2263 2979 4.212716 AGGATGCTGAATGTGTGCATATT 58.787 39.13 0.0 0.0 45.9 1.28 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
233 234 2.257409 CTTCTGCGCCTACCCACCAT 62.257 60.000 4.18 0.0 0.00 3.55
604 605 0.734889 CACATCTTCCAATGCCGTCC 59.265 55.000 0.00 0.0 0.00 4.79
695 696 1.448540 GCAGTGCGTGTATCTGCCT 60.449 57.895 0.00 0.0 45.76 4.75
811 820 0.170561 GTACGTCCGTGATGCTCACT 59.829 55.000 1.98 0.0 44.85 3.41
2099 2813 1.301293 CAACCTCTTCAGGCTCCCC 59.699 63.158 0.00 0.0 45.05 4.81
2198 2912 2.812011 AGGCTTTGATACACACGTTTCC 59.188 45.455 0.00 0.0 0.00 3.13
2263 2979 1.374947 CGCCTTCCCAGTTCTTCCA 59.625 57.895 0.00 0.0 0.00 3.53
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
114 115 1.078143 GGCAGAGGCGATGAGGTTT 60.078 57.895 0.0 0.0 42.47 3.27
233 234 0.396435 ACTGGTGCGGTTCATGAAGA 59.604 50.000 8.8 0.0 0.00 2.87
272 273 1.221840 GTGCCGAGGATGACACCAT 59.778 57.895 0.0 0.0 35.29 3.55
695 696 1.134367 CGAGATGGTGGCGAAACTCTA 59.866 52.381 0.0 0.0 0.00 2.43
811 820 3.690139 GTCTCCGATGAGTCACTAAGTCA 59.310 47.826 0.0 0.0 41.55 3.41
827 836 1.679977 TACTCCGGGTTGGTCTCCG 60.680 63.158 0.0 0.0 45.29 4.63
2263 2979 4.212716 AGGATGCTGAATGTGTGCATATT 58.787 39.130 0.0 0.0 45.90 1.28


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.