Multiple sequence alignment - TraesCS7A01G059300

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS7A01G059300 chr7A 100.000 2306 0 0 1 2306 28915393 28913088 0.000000e+00 4259
1 TraesCS7A01G059300 chr7A 96.777 2327 30 11 1 2306 28845529 28843227 0.000000e+00 3840
2 TraesCS7A01G059300 chr7A 96.691 2327 32 11 1 2306 28808728 28806426 0.000000e+00 3829
3 TraesCS7A01G059300 chr7A 98.080 2031 19 1 1 2011 28968825 28966795 0.000000e+00 3517
4 TraesCS7A01G059300 chr7A 97.390 2031 22 2 1 2011 29009044 29007025 0.000000e+00 3428
5 TraesCS7A01G059300 chr7A 98.990 297 3 0 2010 2306 29006884 29006588 1.210000e-147 532
6 TraesCS7A01G059300 chr7A 98.190 221 3 1 2010 2230 28966653 28966434 3.590000e-103 385
7 TraesCS7A01G059300 chr7A 98.765 81 1 0 2226 2306 28954267 28954187 6.640000e-31 145
8 TraesCS7A01G059300 chrUn 97.343 2032 28 4 1 2011 313533173 313531147 0.000000e+00 3430
9 TraesCS7A01G059300 chrUn 90.806 1414 109 4 1 1393 381415746 381414333 0.000000e+00 1871
10 TraesCS7A01G059300 chrUn 99.663 297 1 0 2010 2306 313531006 313530710 5.600000e-151 544
11 TraesCS7A01G059300 chrUn 83.154 279 24 13 1489 1767 459694204 459694459 1.380000e-57 233
12 TraesCS7A01G059300 chrUn 83.432 169 24 2 2142 2306 347629811 347629643 1.100000e-33 154
13 TraesCS7A01G059300 chr4A 93.720 1688 75 5 1 1659 702327597 702325912 0.000000e+00 2501
14 TraesCS7A01G059300 chr4A 87.954 1735 153 17 1 1703 702352935 702351225 0.000000e+00 1995
15 TraesCS7A01G059300 chr4A 86.512 1683 186 13 1 1651 702298597 702296924 0.000000e+00 1812
16 TraesCS7A01G059300 chr4A 86.557 305 33 4 2010 2306 702321086 702320782 1.710000e-86 329
17 TraesCS7A01G059300 chr7D 87.612 1792 162 25 19 1770 28578344 28576573 0.000000e+00 2025
18 TraesCS7A01G059300 chr1D 85.879 1565 189 11 1 1538 33595954 33597513 0.000000e+00 1637


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS7A01G059300 chr7A 28913088 28915393 2305 True 4259 4259 100.000 1 2306 1 chr7A.!!$R3 2305
1 TraesCS7A01G059300 chr7A 28843227 28845529 2302 True 3840 3840 96.777 1 2306 1 chr7A.!!$R2 2305
2 TraesCS7A01G059300 chr7A 28806426 28808728 2302 True 3829 3829 96.691 1 2306 1 chr7A.!!$R1 2305
3 TraesCS7A01G059300 chr7A 29006588 29009044 2456 True 1980 3428 98.190 1 2306 2 chr7A.!!$R6 2305
4 TraesCS7A01G059300 chr7A 28966434 28968825 2391 True 1951 3517 98.135 1 2230 2 chr7A.!!$R5 2229
5 TraesCS7A01G059300 chrUn 313530710 313533173 2463 True 1987 3430 98.503 1 2306 2 chrUn.!!$R3 2305
6 TraesCS7A01G059300 chrUn 381414333 381415746 1413 True 1871 1871 90.806 1 1393 1 chrUn.!!$R2 1392
7 TraesCS7A01G059300 chr4A 702325912 702327597 1685 True 2501 2501 93.720 1 1659 1 chr4A.!!$R3 1658
8 TraesCS7A01G059300 chr4A 702351225 702352935 1710 True 1995 1995 87.954 1 1703 1 chr4A.!!$R4 1702
9 TraesCS7A01G059300 chr4A 702296924 702298597 1673 True 1812 1812 86.512 1 1651 1 chr4A.!!$R1 1650
10 TraesCS7A01G059300 chr7D 28576573 28578344 1771 True 2025 2025 87.612 19 1770 1 chr7D.!!$R1 1751
11 TraesCS7A01G059300 chr1D 33595954 33597513 1559 False 1637 1637 85.879 1 1538 1 chr1D.!!$F1 1537

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
177 178 1.134220 ACACTGTTGGATTCACGTGGT 60.134 47.619 17.00 4.74 0.0 4.16 F
496 517 1.276989 CTGGGCCGGAAACTAACTACA 59.723 52.381 6.48 0.00 0.0 2.74 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1044 1071 0.178955 TCCTCGGTACAACCACCTCA 60.179 55.000 0.00 0.00 38.47 3.86 R
1851 1915 1.891811 ACATCGAGATCTCCGCATGAT 59.108 47.619 22.16 14.42 0.00 2.45 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
177 178 1.134220 ACACTGTTGGATTCACGTGGT 60.134 47.619 17.00 4.74 0.00 4.16
258 259 2.267961 GCCTACCCACCACCTTCG 59.732 66.667 0.00 0.00 0.00 3.79
349 350 4.435436 CACGCTAGTGGCCGCTCA 62.435 66.667 25.14 8.66 44.34 4.26
496 517 1.276989 CTGGGCCGGAAACTAACTACA 59.723 52.381 6.48 0.00 0.00 2.74
1044 1071 3.645975 CGCGCCGACAACAGGTTT 61.646 61.111 0.00 0.00 0.00 3.27
1449 1492 9.287373 ACCTTGTTCTTATTCCGTTTTGTTATA 57.713 29.630 0.00 0.00 0.00 0.98
2108 2315 0.531532 CATCCTGATCTCGCGCCTTT 60.532 55.000 0.00 0.00 0.00 3.11
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
258 259 1.542915 TCTAGTACTGGTGCGGTTCAC 59.457 52.381 5.39 0.00 44.90 3.18
300 301 3.050275 GCTGGTTGTGCCGAGGAC 61.050 66.667 0.00 0.00 41.21 3.85
496 517 2.750350 CTTGGACGGGTTGAGCCT 59.250 61.111 0.00 0.00 37.43 4.58
1044 1071 0.178955 TCCTCGGTACAACCACCTCA 60.179 55.000 0.00 0.00 38.47 3.86
1449 1492 5.299531 CAGATATACCCATCGGTCGATACAT 59.700 44.000 5.50 0.82 43.29 2.29
1851 1915 1.891811 ACATCGAGATCTCCGCATGAT 59.108 47.619 22.16 14.42 0.00 2.45
2108 2315 2.575735 TGTGCATATGGGAAGAACTGGA 59.424 45.455 4.56 0.00 0.00 3.86


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.