Multiple sequence alignment - TraesCS7A01G059200

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS7A01G059200 chr7A 100.000 3543 0 0 1 3543 28865787 28862245 0.000000e+00 6543.0
1 TraesCS7A01G059200 chr7A 98.505 3544 52 1 1 3543 28935764 28932221 0.000000e+00 6250.0
2 TraesCS7A01G059200 chr7A 96.999 3566 83 3 2 3543 28824657 28821092 0.000000e+00 5971.0
3 TraesCS7A01G059200 chr7A 96.638 3569 74 9 1 3543 28988260 28984712 0.000000e+00 5884.0
4 TraesCS7A01G059200 chr7A 99.200 2376 15 2 1169 3543 28893565 28891193 0.000000e+00 4279.0
5 TraesCS7A01G059200 chr7A 99.164 1077 9 0 1 1077 28894688 28893612 0.000000e+00 1940.0
6 TraesCS7A01G059200 chrUn 97.284 2798 62 2 152 2935 330029303 330032100 0.000000e+00 4734.0
7 TraesCS7A01G059200 chrUn 97.212 2798 64 2 152 2935 330026405 330029202 0.000000e+00 4723.0
8 TraesCS7A01G059200 chrUn 97.104 2141 51 2 1413 3543 241301508 241299369 0.000000e+00 3600.0
9 TraesCS7A01G059200 chrUn 97.057 2141 52 2 1413 3543 317311742 317309603 0.000000e+00 3594.0
10 TraesCS7A01G059200 chrUn 97.173 1875 43 3 1675 3539 235336906 235338780 0.000000e+00 3160.0
11 TraesCS7A01G059200 chrUn 97.173 1875 42 4 1675 3539 333417012 333415139 0.000000e+00 3158.0
12 TraesCS7A01G059200 chrUn 96.319 1141 27 3 285 1411 434496562 434495423 0.000000e+00 1860.0
13 TraesCS7A01G059200 chrUn 96.384 885 18 2 152 1022 461961560 461962444 0.000000e+00 1445.0
14 TraesCS7A01G059200 chrUn 98.929 280 3 0 4 283 469655351 469655072 5.280000e-138 501.0
15 TraesCS7A01G059200 chrUn 98.000 150 3 0 1 150 324332242 324332391 9.760000e-66 261.0
16 TraesCS7A01G059200 chrUn 98.000 150 3 0 1 150 324335396 324335545 9.760000e-66 261.0
17 TraesCS7A01G059200 chrUn 98.639 147 2 0 4 150 340810456 340810310 9.760000e-66 261.0
18 TraesCS7A01G059200 chr4B 96.120 2809 89 6 149 2940 3324266 3321461 0.000000e+00 4566.0
19 TraesCS7A01G059200 chr4B 91.460 363 19 2 3005 3355 3321319 3320957 4.110000e-134 488.0
20 TraesCS7A01G059200 chr3A 96.299 1216 33 2 2340 3543 574287400 574288615 0.000000e+00 1986.0
21 TraesCS7A01G059200 chr2B 97.537 609 14 1 2 610 788186691 788187298 0.000000e+00 1040.0
22 TraesCS7A01G059200 chr2B 83.855 799 117 10 1002 1791 392029991 392030786 0.000000e+00 750.0
23 TraesCS7A01G059200 chr4A 95.972 422 16 1 4 424 738865947 738866368 0.000000e+00 684.0
24 TraesCS7A01G059200 chr5D 85.904 603 84 1 1001 1602 127930521 127929919 2.980000e-180 641.0
25 TraesCS7A01G059200 chr5D 82.701 422 39 16 464 878 127931192 127930798 9.420000e-91 344.0
26 TraesCS7A01G059200 chr1D 85.738 603 85 1 1001 1602 415605119 415605721 1.390000e-178 636.0
27 TraesCS7A01G059200 chr1D 88.667 300 34 0 4 303 387188155 387188454 2.010000e-97 366.0
28 TraesCS7A01G059200 chr1D 94.792 96 4 1 2919 3013 19257245 19257150 7.920000e-32 148.0
29 TraesCS7A01G059200 chr2D 94.307 404 22 1 4 406 129159508 129159105 5.030000e-173 617.0
30 TraesCS7A01G059200 chr6D 84.565 609 87 2 1001 1602 450179744 450179136 6.550000e-167 597.0
31 TraesCS7A01G059200 chr6D 92.157 51 4 0 464 514 450180370 450180320 4.910000e-09 73.1
32 TraesCS7A01G059200 chr1B 88.810 420 47 0 5 424 520406434 520406853 1.890000e-142 516.0
33 TraesCS7A01G059200 chr6B 93.357 286 18 1 1 285 603759193 603759478 4.230000e-114 422.0
34 TraesCS7A01G059200 chr7D 91.270 252 22 0 4 255 38092621 38092872 9.420000e-91 344.0
35 TraesCS7A01G059200 chr7D 82.353 425 41 16 461 878 340190801 340191198 4.380000e-89 339.0


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS7A01G059200 chr7A 28862245 28865787 3542 True 6543.00 6543 100.0000 1 3543 1 chr7A.!!$R2 3542
1 TraesCS7A01G059200 chr7A 28932221 28935764 3543 True 6250.00 6250 98.5050 1 3543 1 chr7A.!!$R3 3542
2 TraesCS7A01G059200 chr7A 28821092 28824657 3565 True 5971.00 5971 96.9990 2 3543 1 chr7A.!!$R1 3541
3 TraesCS7A01G059200 chr7A 28984712 28988260 3548 True 5884.00 5884 96.6380 1 3543 1 chr7A.!!$R4 3542
4 TraesCS7A01G059200 chr7A 28891193 28894688 3495 True 3109.50 4279 99.1820 1 3543 2 chr7A.!!$R5 3542
5 TraesCS7A01G059200 chrUn 330026405 330032100 5695 False 4728.50 4734 97.2480 152 2935 2 chrUn.!!$F4 2783
6 TraesCS7A01G059200 chrUn 241299369 241301508 2139 True 3600.00 3600 97.1040 1413 3543 1 chrUn.!!$R1 2130
7 TraesCS7A01G059200 chrUn 317309603 317311742 2139 True 3594.00 3594 97.0570 1413 3543 1 chrUn.!!$R2 2130
8 TraesCS7A01G059200 chrUn 235336906 235338780 1874 False 3160.00 3160 97.1730 1675 3539 1 chrUn.!!$F1 1864
9 TraesCS7A01G059200 chrUn 333415139 333417012 1873 True 3158.00 3158 97.1730 1675 3539 1 chrUn.!!$R3 1864
10 TraesCS7A01G059200 chrUn 434495423 434496562 1139 True 1860.00 1860 96.3190 285 1411 1 chrUn.!!$R5 1126
11 TraesCS7A01G059200 chrUn 461961560 461962444 884 False 1445.00 1445 96.3840 152 1022 1 chrUn.!!$F2 870
12 TraesCS7A01G059200 chrUn 324332242 324335545 3303 False 261.00 261 98.0000 1 150 2 chrUn.!!$F3 149
13 TraesCS7A01G059200 chr4B 3320957 3324266 3309 True 2527.00 4566 93.7900 149 3355 2 chr4B.!!$R1 3206
14 TraesCS7A01G059200 chr3A 574287400 574288615 1215 False 1986.00 1986 96.2990 2340 3543 1 chr3A.!!$F1 1203
15 TraesCS7A01G059200 chr2B 788186691 788187298 607 False 1040.00 1040 97.5370 2 610 1 chr2B.!!$F2 608
16 TraesCS7A01G059200 chr2B 392029991 392030786 795 False 750.00 750 83.8550 1002 1791 1 chr2B.!!$F1 789
17 TraesCS7A01G059200 chr5D 127929919 127931192 1273 True 492.50 641 84.3025 464 1602 2 chr5D.!!$R1 1138
18 TraesCS7A01G059200 chr1D 415605119 415605721 602 False 636.00 636 85.7380 1001 1602 1 chr1D.!!$F2 601
19 TraesCS7A01G059200 chr6D 450179136 450180370 1234 True 335.05 597 88.3610 464 1602 2 chr6D.!!$R1 1138

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
259 3497 1.024579 GTGCCCTTGTGTATGTCCGG 61.025 60.000 0.00 0.00 0.00 5.14 F
905 5171 2.353889 CGTACGTCTAGTGGCACATAGT 59.646 50.000 21.41 13.79 44.52 2.12 F
1742 6250 1.836166 CTGTCTCATCACCACCTCCAT 59.164 52.381 0.00 0.00 0.00 3.41 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1742 6250 0.172578 CGGATGTCTCGTTGTGCCTA 59.827 55.000 0.00 0.0 0.0 3.93 R
2484 7047 7.430502 CCAATGCTTTCTTCGAATTGTTATCTC 59.569 37.037 0.00 0.0 0.0 2.75 R
3224 7882 1.169661 TCGTTTGGTTGGCGCAGATT 61.170 50.000 10.83 0.0 0.0 2.40 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
259 3497 1.024579 GTGCCCTTGTGTATGTCCGG 61.025 60.000 0.00 0.00 0.00 5.14
905 5171 2.353889 CGTACGTCTAGTGGCACATAGT 59.646 50.000 21.41 13.79 44.52 2.12
1742 6250 1.836166 CTGTCTCATCACCACCTCCAT 59.164 52.381 0.00 0.00 0.00 3.41
2484 7047 2.545742 CGCCCAAAAGGAAGAAACTTGG 60.546 50.000 0.00 0.00 38.24 3.61
2943 7512 9.551734 GTGTTAATAATTACTCCCTCCGTAAAT 57.448 33.333 0.00 0.00 31.36 1.40
3033 7679 9.416794 GGAGTAGATATCAAGTGTCATATTGTG 57.583 37.037 5.32 0.00 0.00 3.33
3224 7882 2.035321 GCTGATTGGAAAACGGGAACAA 59.965 45.455 0.00 0.00 0.00 2.83
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
70 72 3.117398 TCTCTGGCTACTTAATACCCCGA 60.117 47.826 0.00 0.0 0.00 5.14
1742 6250 0.172578 CGGATGTCTCGTTGTGCCTA 59.827 55.000 0.00 0.0 0.00 3.93
1848 6411 7.463431 ACCATTGGTAAAACATACTTACTGGA 58.537 34.615 6.54 0.0 32.11 3.86
2484 7047 7.430502 CCAATGCTTTCTTCGAATTGTTATCTC 59.569 37.037 0.00 0.0 0.00 2.75
2909 7477 8.863872 GGGAGTAATTATTAACACTGCCATAT 57.136 34.615 18.26 0.0 45.76 1.78
3002 7594 6.065374 TGACACTTGATATCTACTCCCTCTC 58.935 44.000 3.98 0.0 0.00 3.20
3033 7679 2.558359 AGCCTTAATGCAAGTTGTCCAC 59.442 45.455 4.48 0.0 31.77 4.02
3224 7882 1.169661 TCGTTTGGTTGGCGCAGATT 61.170 50.000 10.83 0.0 0.00 2.40


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.