Multiple sequence alignment - TraesCS7A01G057600

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS7A01G057600 chr7A 100.000 2375 0 0 1 2375 27876008 27873634 0.000000e+00 4386
1 TraesCS7A01G057600 chr7A 97.815 2380 46 3 1 2375 690641356 690638978 0.000000e+00 4102
2 TraesCS7A01G057600 chr4A 97.729 2378 50 4 1 2375 552878857 552876481 0.000000e+00 4089
3 TraesCS7A01G057600 chr1A 95.919 2377 92 5 1 2375 10896836 10894463 0.000000e+00 3847
4 TraesCS7A01G057600 chr1A 95.835 2377 93 6 1 2375 10841881 10839509 0.000000e+00 3836
5 TraesCS7A01G057600 chr1A 94.488 127 6 1 2249 2375 10838005 10837880 6.700000e-46 195
6 TraesCS7A01G057600 chr1A 94.488 127 6 1 2249 2375 10893300 10893175 6.700000e-46 195
7 TraesCS7A01G057600 chr7D 95.745 1833 47 13 1 1828 549261335 549263141 0.000000e+00 2924
8 TraesCS7A01G057600 chr7D 95.417 1833 54 12 1 1829 461637765 461635959 0.000000e+00 2892
9 TraesCS7A01G057600 chr7D 92.126 127 9 1 2249 2375 461635117 461634992 6.750000e-41 178
10 TraesCS7A01G057600 chr7D 91.597 119 9 1 2031 2149 461635949 461635832 1.890000e-36 163
11 TraesCS7A01G057600 chr2D 95.581 1833 51 13 1 1829 617005905 617004099 0.000000e+00 2909
12 TraesCS7A01G057600 chr2D 92.913 127 8 1 2249 2375 617003753 617003628 1.450000e-42 183
13 TraesCS7A01G057600 chr2D 92.126 127 9 1 2249 2375 617003336 617003211 6.750000e-41 178
14 TraesCS7A01G057600 chr2D 92.437 119 8 1 2031 2149 617004089 617003972 4.060000e-38 169
15 TraesCS7A01G057600 chr2B 97.161 1268 35 1 1 1267 63145771 63147038 0.000000e+00 2141


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS7A01G057600 chr7A 27873634 27876008 2374 True 4386.000000 4386 100.000000 1 2375 1 chr7A.!!$R1 2374
1 TraesCS7A01G057600 chr7A 690638978 690641356 2378 True 4102.000000 4102 97.815000 1 2375 1 chr7A.!!$R2 2374
2 TraesCS7A01G057600 chr4A 552876481 552878857 2376 True 4089.000000 4089 97.729000 1 2375 1 chr4A.!!$R1 2374
3 TraesCS7A01G057600 chr1A 10893175 10896836 3661 True 2021.000000 3847 95.203500 1 2375 2 chr1A.!!$R2 2374
4 TraesCS7A01G057600 chr1A 10837880 10841881 4001 True 2015.500000 3836 95.161500 1 2375 2 chr1A.!!$R1 2374
5 TraesCS7A01G057600 chr7D 549261335 549263141 1806 False 2924.000000 2924 95.745000 1 1828 1 chr7D.!!$F1 1827
6 TraesCS7A01G057600 chr7D 461634992 461637765 2773 True 1077.666667 2892 93.046667 1 2375 3 chr7D.!!$R1 2374
7 TraesCS7A01G057600 chr2D 617003211 617005905 2694 True 859.750000 2909 93.264250 1 2375 4 chr2D.!!$R1 2374
8 TraesCS7A01G057600 chr2B 63145771 63147038 1267 False 2141.000000 2141 97.161000 1 1267 1 chr2B.!!$F1 1266

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
181 182 2.162681 AGGAAGATTTTGCCAAGGACG 58.837 47.619 0.0 0.0 0.0 4.79 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1930 1943 0.541392 ACATTCATCAGGCGGCAGTA 59.459 50.0 13.08 0.0 0.0 2.74 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
181 182 2.162681 AGGAAGATTTTGCCAAGGACG 58.837 47.619 0.00 0.0 0.00 4.79
334 337 5.674525 AGTTCAAGGCGAATTATGAGATCA 58.325 37.500 0.00 0.0 35.63 2.92
472 475 4.225942 TGAACTCTAGGCTCCACAATCATT 59.774 41.667 0.00 0.0 0.00 2.57
642 645 5.820423 TGCTGCTCGTATTTATACACCAAAT 59.180 36.000 0.00 0.0 32.87 2.32
1006 1010 3.643320 TGTGTGGTCAGAAGAGATGAGTT 59.357 43.478 0.00 0.0 0.00 3.01
1143 1147 5.601662 GAGAATGATGATAACACCGAGGAA 58.398 41.667 0.00 0.0 0.00 3.36
1224 1228 7.694093 AGAGAGTCCTTGATCCAAAAATAGTT 58.306 34.615 0.00 0.0 0.00 2.24
1316 1320 4.096682 GCGGAAGAAGAGAACTAGAAGCTA 59.903 45.833 0.00 0.0 0.00 3.32
1348 1352 2.185004 AAGTTCCGAACATGACAGGG 57.815 50.000 13.69 0.0 0.00 4.45
1630 1641 3.440173 CCTGTTAAATCTGTTGGCGTGAT 59.560 43.478 0.00 0.0 0.00 3.06
1702 1713 2.426522 TGCTTGCAGACACTTATCACC 58.573 47.619 0.00 0.0 0.00 4.02
1790 1803 6.959639 TGGCTCCAGGTTATTTAATGAATC 57.040 37.500 0.00 0.0 0.00 2.52
1861 1874 4.947388 GGGTTATGCATGGTTAGAGTTTGA 59.053 41.667 10.16 0.0 0.00 2.69
2103 2117 1.338769 GCCATGTTAGTGGTCCTCGTT 60.339 52.381 0.00 0.0 41.47 3.85
2221 2235 6.017852 GTGCAACCTAGACCTATCAAATAAGC 60.018 42.308 0.00 0.0 0.00 3.09
2223 2237 6.689177 GCAACCTAGACCTATCAAATAAGCCT 60.689 42.308 0.00 0.0 0.00 4.58
2287 2420 6.241645 AGTGCTTCTAGAATTGCCTTTACTT 58.758 36.000 5.44 0.0 0.00 2.24
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
181 182 0.179045 AACTGCATAGCCGATGGTCC 60.179 55.000 0.00 0.0 35.91 4.46
334 337 5.044624 TGGACATCCATTCATTCTCCTCTTT 60.045 40.000 0.00 0.0 42.01 2.52
472 475 1.604755 CAACGACATTTTCCGGTCCAA 59.395 47.619 0.00 0.0 0.00 3.53
915 919 2.685897 TGTCCACCTTTTGCTAACACAC 59.314 45.455 0.00 0.0 0.00 3.82
1006 1010 4.126208 TGTTTCTCAGTTCACGGTAACA 57.874 40.909 5.15 0.0 0.00 2.41
1316 1320 1.538075 CGGAACTTTTACATTGGCCGT 59.462 47.619 0.00 0.0 33.35 5.68
1348 1352 4.519906 TCCCTAAATCTGGACATTTCCC 57.480 45.455 0.00 0.0 42.01 3.97
1702 1713 3.211803 TCGTCAAGTATCACGACCAAG 57.788 47.619 0.00 0.0 40.05 3.61
1861 1874 3.251729 CCGCTCATAAATAGCAGCACATT 59.748 43.478 0.00 0.0 40.08 2.71
1930 1943 0.541392 ACATTCATCAGGCGGCAGTA 59.459 50.000 13.08 0.0 0.00 2.74
2103 2117 6.373216 CCCGAATAAATCTCAGGTACAAACAA 59.627 38.462 0.00 0.0 0.00 2.83
2149 2163 8.487313 TCACTAAAATAACGAGTGTAATGCAT 57.513 30.769 0.00 0.0 41.14 3.96


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.