Multiple sequence alignment - TraesCS7A01G050700

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS7A01G050700 chr7A 100.000 4361 0 0 1 4361 24277354 24281714 0.000000e+00 8054.0
1 TraesCS7A01G050700 chr7A 98.962 3855 34 3 1 3850 23893977 23897830 0.000000e+00 6892.0
2 TraesCS7A01G050700 chr7A 99.070 3118 23 3 738 3850 24094369 24097485 0.000000e+00 5592.0
3 TraesCS7A01G050700 chr7A 96.032 3125 91 17 743 3847 23786686 23789797 0.000000e+00 5053.0
4 TraesCS7A01G050700 chr7A 96.419 754 8 1 1 754 24093615 24094349 0.000000e+00 1225.0
5 TraesCS7A01G050700 chr7A 77.716 1988 373 46 1214 3172 22626245 22628191 0.000000e+00 1153.0
6 TraesCS7A01G050700 chr7A 93.462 520 24 6 3848 4361 607695 607180 0.000000e+00 763.0
7 TraesCS7A01G050700 chr7A 82.542 653 111 1 1214 1863 22666155 22666807 4.890000e-159 571.0
8 TraesCS7A01G050700 chr7A 74.759 1244 247 49 1962 3174 23363421 23364628 3.030000e-136 496.0
9 TraesCS7A01G050700 chr7A 91.724 145 10 2 3848 3991 152192020 152191877 2.660000e-47 200.0
10 TraesCS7A01G050700 chr4A 93.407 1714 90 7 2149 3847 706498302 706496597 0.000000e+00 2518.0
11 TraesCS7A01G050700 chr4A 95.779 1374 50 5 796 2167 706499681 706498314 0.000000e+00 2209.0
12 TraesCS7A01G050700 chr4A 83.958 2213 266 48 1041 3191 706553118 706555303 0.000000e+00 2037.0
13 TraesCS7A01G050700 chr4A 91.773 705 55 3 1 704 706501557 706500855 0.000000e+00 977.0
14 TraesCS7A01G050700 chr4A 94.391 517 20 5 3848 4361 168005705 168005195 0.000000e+00 785.0
15 TraesCS7A01G050700 chr4A 94.015 518 24 5 3848 4361 79581061 79581575 0.000000e+00 778.0
16 TraesCS7A01G050700 chr4A 82.562 648 110 3 1214 1858 704302365 704301718 6.330000e-158 568.0
17 TraesCS7A01G050700 chr4A 76.623 1001 208 23 2199 3190 706837701 706836718 2.990000e-146 529.0
18 TraesCS7A01G050700 chr4A 85.185 135 15 5 348 478 706501135 706501002 2.740000e-27 134.0
19 TraesCS7A01G050700 chr7D 84.576 966 92 29 1014 1957 23071503 23070573 0.000000e+00 905.0
20 TraesCS7A01G050700 chr7D 79.444 1007 178 22 2195 3190 21938671 21937683 0.000000e+00 686.0
21 TraesCS7A01G050700 chr7D 82.051 663 115 2 1214 1872 22039096 22039758 2.940000e-156 562.0
22 TraesCS7A01G050700 chr6A 95.385 520 19 4 3844 4361 257311577 257311061 0.000000e+00 822.0
23 TraesCS7A01G050700 chr6A 94.186 516 26 3 3848 4361 261159327 261159840 0.000000e+00 784.0
24 TraesCS7A01G050700 chr6A 92.265 543 25 12 3823 4361 77326732 77326203 0.000000e+00 754.0
25 TraesCS7A01G050700 chr2A 94.595 518 21 6 3848 4361 93813401 93813915 0.000000e+00 795.0
26 TraesCS7A01G050700 chr2A 94.369 515 26 2 3848 4361 749120740 749121252 0.000000e+00 787.0
27 TraesCS7A01G050700 chr2A 94.220 519 23 4 3848 4361 149604665 149604149 0.000000e+00 785.0
28 TraesCS7A01G050700 chr2A 79.063 363 68 7 2194 2552 81066116 81066474 4.360000e-60 243.0
29 TraesCS7A01G050700 chr1A 93.592 515 26 4 3848 4361 592198010 592198518 0.000000e+00 761.0
30 TraesCS7A01G050700 chrUn 82.716 648 109 3 1214 1858 313747296 313746649 1.360000e-159 573.0
31 TraesCS7A01G050700 chrUn 82.562 648 110 3 1214 1858 50554660 50554013 6.330000e-158 568.0
32 TraesCS7A01G050700 chr5A 74.616 1237 257 42 1962 3174 41967562 41968765 3.920000e-135 492.0
33 TraesCS7A01G050700 chr5A 75.294 170 30 11 312 476 663564326 663564488 2.180000e-08 71.3
34 TraesCS7A01G050700 chr2B 79.603 353 68 4 2202 2552 132279119 132279469 2.600000e-62 250.0
35 TraesCS7A01G050700 chr2D 78.670 361 69 7 2194 2552 80658010 80658364 2.620000e-57 233.0
36 TraesCS7A01G050700 chr3D 80.645 124 15 9 351 469 180243752 180243871 2.160000e-13 87.9
37 TraesCS7A01G050700 chr3D 76.220 164 24 12 319 476 609253772 609253618 6.050000e-09 73.1
38 TraesCS7A01G050700 chr5D 77.372 137 22 9 344 476 449129659 449129790 6.050000e-09 73.1
39 TraesCS7A01G050700 chr1D 76.433 157 23 11 350 498 41762941 41762791 6.050000e-09 73.1


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS7A01G050700 chr7A 24277354 24281714 4360 False 8054.0 8054 100.0000 1 4361 1 chr7A.!!$F6 4360
1 TraesCS7A01G050700 chr7A 23893977 23897830 3853 False 6892.0 6892 98.9620 1 3850 1 chr7A.!!$F5 3849
2 TraesCS7A01G050700 chr7A 23786686 23789797 3111 False 5053.0 5053 96.0320 743 3847 1 chr7A.!!$F4 3104
3 TraesCS7A01G050700 chr7A 24093615 24097485 3870 False 3408.5 5592 97.7445 1 3850 2 chr7A.!!$F7 3849
4 TraesCS7A01G050700 chr7A 22626245 22628191 1946 False 1153.0 1153 77.7160 1214 3172 1 chr7A.!!$F1 1958
5 TraesCS7A01G050700 chr7A 607180 607695 515 True 763.0 763 93.4620 3848 4361 1 chr7A.!!$R1 513
6 TraesCS7A01G050700 chr7A 22666155 22666807 652 False 571.0 571 82.5420 1214 1863 1 chr7A.!!$F2 649
7 TraesCS7A01G050700 chr7A 23363421 23364628 1207 False 496.0 496 74.7590 1962 3174 1 chr7A.!!$F3 1212
8 TraesCS7A01G050700 chr4A 706553118 706555303 2185 False 2037.0 2037 83.9580 1041 3191 1 chr4A.!!$F2 2150
9 TraesCS7A01G050700 chr4A 706496597 706501557 4960 True 1459.5 2518 91.5360 1 3847 4 chr4A.!!$R4 3846
10 TraesCS7A01G050700 chr4A 168005195 168005705 510 True 785.0 785 94.3910 3848 4361 1 chr4A.!!$R1 513
11 TraesCS7A01G050700 chr4A 79581061 79581575 514 False 778.0 778 94.0150 3848 4361 1 chr4A.!!$F1 513
12 TraesCS7A01G050700 chr4A 704301718 704302365 647 True 568.0 568 82.5620 1214 1858 1 chr4A.!!$R2 644
13 TraesCS7A01G050700 chr4A 706836718 706837701 983 True 529.0 529 76.6230 2199 3190 1 chr4A.!!$R3 991
14 TraesCS7A01G050700 chr7D 23070573 23071503 930 True 905.0 905 84.5760 1014 1957 1 chr7D.!!$R2 943
15 TraesCS7A01G050700 chr7D 21937683 21938671 988 True 686.0 686 79.4440 2195 3190 1 chr7D.!!$R1 995
16 TraesCS7A01G050700 chr7D 22039096 22039758 662 False 562.0 562 82.0510 1214 1872 1 chr7D.!!$F1 658
17 TraesCS7A01G050700 chr6A 257311061 257311577 516 True 822.0 822 95.3850 3844 4361 1 chr6A.!!$R2 517
18 TraesCS7A01G050700 chr6A 261159327 261159840 513 False 784.0 784 94.1860 3848 4361 1 chr6A.!!$F1 513
19 TraesCS7A01G050700 chr6A 77326203 77326732 529 True 754.0 754 92.2650 3823 4361 1 chr6A.!!$R1 538
20 TraesCS7A01G050700 chr2A 93813401 93813915 514 False 795.0 795 94.5950 3848 4361 1 chr2A.!!$F2 513
21 TraesCS7A01G050700 chr2A 749120740 749121252 512 False 787.0 787 94.3690 3848 4361 1 chr2A.!!$F3 513
22 TraesCS7A01G050700 chr2A 149604149 149604665 516 True 785.0 785 94.2200 3848 4361 1 chr2A.!!$R1 513
23 TraesCS7A01G050700 chr1A 592198010 592198518 508 False 761.0 761 93.5920 3848 4361 1 chr1A.!!$F1 513
24 TraesCS7A01G050700 chrUn 313746649 313747296 647 True 573.0 573 82.7160 1214 1858 1 chrUn.!!$R2 644
25 TraesCS7A01G050700 chrUn 50554013 50554660 647 True 568.0 568 82.5620 1214 1858 1 chrUn.!!$R1 644
26 TraesCS7A01G050700 chr5A 41967562 41968765 1203 False 492.0 492 74.6160 1962 3174 1 chr5A.!!$F1 1212

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
982 2080 0.392998 ACCACTTGCCACATCGATCC 60.393 55.000 0.0 0.0 0.00 3.36 F
3281 4524 1.277557 AGAAGCTTGTGAAGGCTCGAT 59.722 47.619 2.1 0.0 37.87 3.59 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
3354 4597 1.274167 ACTCGTCGTTGGCTTTATGGA 59.726 47.619 0.0 0.0 0.0 3.41 R
4221 5485 2.786445 AGGCTGGAGTAGTGAGAGGATA 59.214 50.000 0.0 0.0 0.0 2.59 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
102 103 2.580867 CGAGAGAAAGCTCCGCGG 60.581 66.667 22.12 22.12 42.30 6.46
177 178 0.909610 CCTTGGCCTCTCCCAGTACA 60.910 60.000 3.32 0.00 36.00 2.90
982 2080 0.392998 ACCACTTGCCACATCGATCC 60.393 55.000 0.00 0.00 0.00 3.36
1209 2307 2.352422 GCCATCACCACCTGCAGA 59.648 61.111 17.39 0.00 0.00 4.26
3281 4524 1.277557 AGAAGCTTGTGAAGGCTCGAT 59.722 47.619 2.10 0.00 37.87 3.59
3354 4597 0.913451 AGAAGCAGGGGAGCACAGAT 60.913 55.000 0.00 0.00 36.85 2.90
3393 4640 2.572095 TTCTGCCGTGGTCCATAGCG 62.572 60.000 10.52 2.99 0.00 4.26
3864 5112 3.525800 ATGCACTGGTAGAAAAAGGGT 57.474 42.857 0.00 0.00 0.00 4.34
3873 5121 6.329460 ACTGGTAGAAAAAGGGTCTTTAGTCT 59.671 38.462 9.77 9.77 0.00 3.24
3928 5176 1.753073 CCGGGACTAAAGTGTCGGTAT 59.247 52.381 0.00 0.00 37.81 2.73
3935 5183 5.813672 GGACTAAAGTGTCGGTATTAATGCA 59.186 40.000 5.87 0.00 37.81 3.96
4158 5422 5.403558 TCTCTAATCACCCCTCATCACTA 57.596 43.478 0.00 0.00 0.00 2.74
4211 5475 2.571653 TCCAAATCATCTCACTTCCCGT 59.428 45.455 0.00 0.00 0.00 5.28
4213 5477 4.408921 TCCAAATCATCTCACTTCCCGTAT 59.591 41.667 0.00 0.00 0.00 3.06
4221 5485 0.902531 CACTTCCCGTATGGTCACCT 59.097 55.000 0.00 0.00 34.77 4.00
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
177 178 3.895041 CACCCTGATTGTTGGTAAAAGGT 59.105 43.478 0.00 0.0 0.00 3.50
243 244 6.900568 TCAAAAAGTGTTCGCAAATTCAAT 57.099 29.167 0.00 0.0 0.00 2.57
982 2080 2.489329 ACATTGTTCCAAGGCTCGATTG 59.511 45.455 0.00 0.0 0.00 2.67
3354 4597 1.274167 ACTCGTCGTTGGCTTTATGGA 59.726 47.619 0.00 0.0 0.00 3.41
3393 4640 2.622942 TCCACTGTTTTTGTCAGATGCC 59.377 45.455 0.00 0.0 36.81 4.40
3494 4741 8.264347 TGTATAGCTCAATAACCTTGATCAACA 58.736 33.333 3.38 0.0 0.00 3.33
3721 4968 9.696572 ATAAATAGCCGATACAATAGTCCTAGA 57.303 33.333 0.00 0.0 0.00 2.43
3777 5024 6.412214 AGTATTTGCGGTCCTAAAATAGTGT 58.588 36.000 10.51 0.0 31.41 3.55
3864 5112 3.441572 CCCTTACGAACCGAGACTAAAGA 59.558 47.826 0.00 0.0 0.00 2.52
3873 5121 1.205417 CTAAAGGCCCTTACGAACCGA 59.795 52.381 0.00 0.0 0.00 4.69
3928 5176 4.566907 GGGACTAAAGGGTCAGTGCATTAA 60.567 45.833 0.00 0.0 37.91 1.40
3935 5183 0.178912 ACCGGGACTAAAGGGTCAGT 60.179 55.000 6.32 0.0 37.91 3.41
4158 5422 9.566432 GATGGGTGATTAGAGATTAAATTGAGT 57.434 33.333 0.00 0.0 0.00 3.41
4182 5446 7.230913 GGAAGTGAGATGATTTGGAATGATGAT 59.769 37.037 0.00 0.0 0.00 2.45
4211 5475 4.816048 AGTGAGAGGATAGGTGACCATA 57.184 45.455 3.63 0.0 0.00 2.74
4213 5477 3.528078 AGTAGTGAGAGGATAGGTGACCA 59.472 47.826 3.63 0.0 0.00 4.02
4221 5485 2.786445 AGGCTGGAGTAGTGAGAGGATA 59.214 50.000 0.00 0.0 0.00 2.59


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.