Multiple sequence alignment - TraesCS7A01G035900

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS7A01G035900 chr7A 100.000 2640 0 0 1 2640 16005012 16007651 0.000000e+00 4876
1 TraesCS7A01G035900 chr5B 99.129 2641 20 3 1 2640 471294932 471292294 0.000000e+00 4747
2 TraesCS7A01G035900 chr5B 98.903 2644 23 5 1 2640 351469615 351466974 0.000000e+00 4717
3 TraesCS7A01G035900 chr5B 99.267 2456 14 4 1 2454 433002512 433000059 0.000000e+00 4433
4 TraesCS7A01G035900 chr7B 98.524 2642 35 4 1 2640 102652613 102655252 0.000000e+00 4660
5 TraesCS7A01G035900 chr7B 98.778 2455 27 3 1 2454 133432652 133430200 0.000000e+00 4364
6 TraesCS7A01G035900 chr7B 92.461 703 38 8 1952 2640 235456169 235455468 0.000000e+00 990
7 TraesCS7A01G035900 chr7B 92.873 449 18 8 2204 2640 335929294 335929740 7.970000e-180 640
8 TraesCS7A01G035900 chr4B 98.335 2642 39 5 1 2640 649623168 649625806 0.000000e+00 4630
9 TraesCS7A01G035900 chr4B 98.108 2643 38 6 1 2640 655790979 655793612 0.000000e+00 4593
10 TraesCS7A01G035900 chr1B 98.298 2644 39 5 1 2640 302772357 302769716 0.000000e+00 4628
11 TraesCS7A01G035900 chr6B 98.811 2438 22 4 1 2437 381313993 381311562 0.000000e+00 4335
12 TraesCS7A01G035900 chr6B 88.672 768 38 19 1906 2640 661053584 661054335 0.000000e+00 891


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS7A01G035900 chr7A 16005012 16007651 2639 False 4876 4876 100.000 1 2640 1 chr7A.!!$F1 2639
1 TraesCS7A01G035900 chr5B 471292294 471294932 2638 True 4747 4747 99.129 1 2640 1 chr5B.!!$R3 2639
2 TraesCS7A01G035900 chr5B 351466974 351469615 2641 True 4717 4717 98.903 1 2640 1 chr5B.!!$R1 2639
3 TraesCS7A01G035900 chr5B 433000059 433002512 2453 True 4433 4433 99.267 1 2454 1 chr5B.!!$R2 2453
4 TraesCS7A01G035900 chr7B 102652613 102655252 2639 False 4660 4660 98.524 1 2640 1 chr7B.!!$F1 2639
5 TraesCS7A01G035900 chr7B 133430200 133432652 2452 True 4364 4364 98.778 1 2454 1 chr7B.!!$R1 2453
6 TraesCS7A01G035900 chr7B 235455468 235456169 701 True 990 990 92.461 1952 2640 1 chr7B.!!$R2 688
7 TraesCS7A01G035900 chr4B 649623168 649625806 2638 False 4630 4630 98.335 1 2640 1 chr4B.!!$F1 2639
8 TraesCS7A01G035900 chr4B 655790979 655793612 2633 False 4593 4593 98.108 1 2640 1 chr4B.!!$F2 2639
9 TraesCS7A01G035900 chr1B 302769716 302772357 2641 True 4628 4628 98.298 1 2640 1 chr1B.!!$R1 2639
10 TraesCS7A01G035900 chr6B 381311562 381313993 2431 True 4335 4335 98.811 1 2437 1 chr6B.!!$R1 2436
11 TraesCS7A01G035900 chr6B 661053584 661054335 751 False 891 891 88.672 1906 2640 1 chr6B.!!$F1 734

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
263 264 8.257306 ACATACATGTTAATGATGGAAAAACCC 58.743 33.333 14.22 0.0 37.9 4.11 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1936 1941 0.267054 TCTGGATCTGGGAGGCAGAT 59.733 55.0 0.0 0.0 41.62 2.9 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
263 264 8.257306 ACATACATGTTAATGATGGAAAAACCC 58.743 33.333 14.22 0.00 37.90 4.11
1134 1138 1.541147 CCATGTTGGTGTGGTGATGTC 59.459 52.381 0.00 0.00 31.35 3.06
1424 1428 1.066430 GTGCAGATTGGTTACGGAGGA 60.066 52.381 0.00 0.00 0.00 3.71
2165 2196 2.669569 CACCCAGACGCCAAGGTG 60.670 66.667 0.00 0.00 43.50 4.00
2295 2326 3.322466 AAGGTCCCTGGCGTCTGG 61.322 66.667 5.87 5.87 0.00 3.86
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
263 264 1.338105 TGGAACTCTTGCATCCTCACG 60.338 52.381 4.96 0.00 34.24 4.35
1134 1138 0.535780 TGGACACCTTCAGCTTGCAG 60.536 55.000 0.00 0.00 0.00 4.41
1424 1428 0.386113 GACTCCTCGAATAGGCGCTT 59.614 55.000 7.64 0.52 46.10 4.68
1936 1941 0.267054 TCTGGATCTGGGAGGCAGAT 59.733 55.000 0.00 0.00 41.62 2.90
2295 2326 2.887152 ACAAGAATGCTTTCTGGACACC 59.113 45.455 20.58 0.00 41.42 4.16


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.