Multiple sequence alignment - TraesCS7A01G029400

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS7A01G029400 chr7A 100.000 2615 0 0 1 2615 11992302 11989688 0.000000e+00 4830.0
1 TraesCS7A01G029400 chr7A 81.917 1377 177 40 424 1775 11249284 11250613 0.000000e+00 1098.0
2 TraesCS7A01G029400 chr7A 92.969 128 9 0 2 129 29029035 29029162 1.240000e-43 187.0
3 TraesCS7A01G029400 chr7A 92.248 129 10 0 1 129 368517242 368517114 1.600000e-42 183.0
4 TraesCS7A01G029400 chr7A 90.840 131 10 1 1 129 84563285 84563155 9.620000e-40 174.0
5 TraesCS7A01G029400 chr7A 72.901 262 66 5 881 1139 17208069 17208328 4.640000e-13 86.1
6 TraesCS7A01G029400 chr7D 97.412 2628 53 7 3 2615 12381644 12379017 0.000000e+00 4462.0
7 TraesCS7A01G029400 chr7D 95.349 129 6 0 1 129 12292590 12292718 3.410000e-49 206.0
8 TraesCS7A01G029400 chr4A 89.619 2543 195 38 117 2615 725754142 725756659 0.000000e+00 3169.0
9 TraesCS7A01G029400 chr4A 90.056 2313 173 28 117 2397 725801265 725803552 0.000000e+00 2944.0
10 TraesCS7A01G029400 chr4A 83.147 1074 146 22 713 1775 726100930 726099881 0.000000e+00 948.0
11 TraesCS7A01G029400 chr4A 71.949 549 141 11 895 1440 715954943 715955481 5.830000e-32 148.0
12 TraesCS7A01G029400 chr4A 85.321 109 7 4 495 602 726101076 726100976 1.280000e-18 104.0
13 TraesCS7A01G029400 chr3D 93.023 129 9 0 1 129 59029441 59029569 3.440000e-44 189.0
14 TraesCS7A01G029400 chr3D 90.698 129 12 0 1 129 149930293 149930165 3.460000e-39 172.0
15 TraesCS7A01G029400 chr6B 93.023 129 8 1 2 129 619080919 619081047 1.240000e-43 187.0
16 TraesCS7A01G029400 chr6A 90.083 121 12 0 9 129 456155338 456155218 9.690000e-35 158.0
17 TraesCS7A01G029400 chrUn 73.946 261 63 5 881 1138 89800749 89801007 1.660000e-17 100.0


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS7A01G029400 chr7A 11989688 11992302 2614 True 4830 4830 100.000 1 2615 1 chr7A.!!$R1 2614
1 TraesCS7A01G029400 chr7A 11249284 11250613 1329 False 1098 1098 81.917 424 1775 1 chr7A.!!$F1 1351
2 TraesCS7A01G029400 chr7D 12379017 12381644 2627 True 4462 4462 97.412 3 2615 1 chr7D.!!$R1 2612
3 TraesCS7A01G029400 chr4A 725754142 725756659 2517 False 3169 3169 89.619 117 2615 1 chr4A.!!$F2 2498
4 TraesCS7A01G029400 chr4A 725801265 725803552 2287 False 2944 2944 90.056 117 2397 1 chr4A.!!$F3 2280
5 TraesCS7A01G029400 chr4A 726099881 726101076 1195 True 526 948 84.234 495 1775 2 chr4A.!!$R1 1280

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
98 99 1.865340 GTGGAAGAACGTGGTGTCTTC 59.135 52.381 16.1 16.1 35.64 2.87 F
992 1033 6.062258 ACTTCCAACTAGCCTAATAGCAAA 57.938 37.500 0.0 0.0 34.23 3.68 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1280 1323 0.730265 GACATTACCATTCGCCGCAA 59.270 50.000 0.00 0.0 0.00 4.85 R
1934 1989 1.895131 GAACACATGTTGGGGCTTGAT 59.105 47.619 1.07 0.0 38.56 2.57 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
98 99 1.865340 GTGGAAGAACGTGGTGTCTTC 59.135 52.381 16.10 16.10 35.64 2.87
113 114 8.126700 CGTGGTGTCTTCTTTTACTTATGTTTT 58.873 33.333 0.00 0.00 0.00 2.43
992 1033 6.062258 ACTTCCAACTAGCCTAATAGCAAA 57.938 37.500 0.00 0.00 34.23 3.68
1280 1323 2.108250 ACATACTCAAGGGCCAAGTTGT 59.892 45.455 6.18 10.15 0.00 3.32
1816 1866 0.807275 CTCCATGAGCACGCATCGAA 60.807 55.000 0.00 0.00 0.00 3.71
1934 1989 0.543277 GGATCTCCAGCACCATGTCA 59.457 55.000 0.00 0.00 35.64 3.58
1945 2000 0.409092 ACCATGTCATCAAGCCCCAA 59.591 50.000 0.00 0.00 0.00 4.12
1958 2013 1.985159 AGCCCCAACATGTGTTCTCTA 59.015 47.619 0.00 0.00 35.83 2.43
2023 2078 1.804151 GATTTGCCGTGTGTTGCTCTA 59.196 47.619 0.00 0.00 0.00 2.43
2052 2107 1.869767 CTGCTCAACTGTTGGTCTGAC 59.130 52.381 19.55 0.00 0.00 3.51
2112 2167 0.823356 GCACTGGGCACTTCCTTTCA 60.823 55.000 0.00 0.00 43.97 2.69
2174 2229 1.002251 TGCACCCGTTTTTCGTTCATC 60.002 47.619 0.00 0.00 37.94 2.92
2204 2259 7.462109 TTGGTTTTCAGTCATTCGAATTTTG 57.538 32.000 8.21 7.37 0.00 2.44
2214 2269 9.398170 CAGTCATTCGAATTTTGAACTTGTAAT 57.602 29.630 8.21 0.00 0.00 1.89
2331 2386 6.203723 ACTTCTCAGTTATCTTGCTCAAACAC 59.796 38.462 0.00 0.00 0.00 3.32
2347 2402 6.127897 GCTCAAACACTGCTCAAATAGGTTAT 60.128 38.462 0.00 0.00 0.00 1.89
2421 2477 4.707934 TCTCCGTATCTTGATTGTACACCA 59.292 41.667 0.00 0.00 0.00 4.17
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
29 30 4.906065 TCAATAATACGTACGGCTGAGT 57.094 40.909 21.06 3.68 0.00 3.41
992 1033 2.031919 TCGCCGACATTGTTGCCT 59.968 55.556 0.00 0.00 0.00 4.75
1088 1129 2.673258 AGTTGGTTACCTTGGGTTTGG 58.327 47.619 2.07 0.00 37.09 3.28
1280 1323 0.730265 GACATTACCATTCGCCGCAA 59.270 50.000 0.00 0.00 0.00 4.85
1717 1766 6.966632 GCATATATCACAAGCGAAAGTGAAAA 59.033 34.615 8.04 1.87 46.62 2.29
1816 1866 2.608988 CTGGCTCCCACACTCCCT 60.609 66.667 0.00 0.00 0.00 4.20
1934 1989 1.895131 GAACACATGTTGGGGCTTGAT 59.105 47.619 1.07 0.00 38.56 2.57
2023 2078 3.137446 ACAGTTGAGCAGCTGATCTTT 57.863 42.857 30.29 14.37 41.41 2.52
2052 2107 7.436673 TGACAAAATAAACCTCACAAATTTCCG 59.563 33.333 0.00 0.00 0.00 4.30
2174 2229 3.996150 ATGACTGAAAACCAAGCACTG 57.004 42.857 0.00 0.00 0.00 3.66
2204 2259 9.052759 TGAGGACAGAAAAGTTATTACAAGTTC 57.947 33.333 0.00 0.00 0.00 3.01
2331 2386 8.668510 ATGAAGTACATAACCTATTTGAGCAG 57.331 34.615 0.00 0.00 37.46 4.24
2347 2402 4.337836 TGAGCAAGCAAACAATGAAGTACA 59.662 37.500 0.00 0.00 0.00 2.90


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.