Multiple sequence alignment - TraesCS7A01G028900

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS7A01G028900 chr7A 100.000 1893 0 0 420 2312 11844464 11846356 0.000000e+00 3496.0
1 TraesCS7A01G028900 chr7A 97.944 1897 34 2 420 2312 11944056 11945951 0.000000e+00 3282.0
2 TraesCS7A01G028900 chr7A 99.614 1296 4 1 1018 2312 11891004 11892299 0.000000e+00 2364.0
3 TraesCS7A01G028900 chr7A 88.698 991 108 4 428 1417 11582399 11581412 0.000000e+00 1206.0
4 TraesCS7A01G028900 chr7A 100.000 119 0 0 1 119 11844045 11844163 1.080000e-53 220.0
5 TraesCS7A01G028900 chr7A 100.000 119 0 0 1 119 11943896 11944014 1.080000e-53 220.0
6 TraesCS7A01G028900 chr7B 93.363 1371 75 7 420 1788 717029129 717027773 0.000000e+00 2013.0
7 TraesCS7A01G028900 chr7B 94.097 1118 62 3 873 1987 717052470 717051354 0.000000e+00 1696.0
8 TraesCS7A01G028900 chr7B 92.424 330 20 4 1984 2312 717038784 717038459 1.250000e-127 466.0
9 TraesCS7A01G028900 chr7B 90.000 350 30 4 1837 2184 717027589 717027243 4.530000e-122 448.0
10 TraesCS7A01G028900 chr7B 94.203 138 6 2 2176 2312 717026156 717026020 2.330000e-50 209.0
11 TraesCS7A01G028900 chr7B 96.639 119 4 0 1 119 717029283 717029165 5.040000e-47 198.0
12 TraesCS7A01G028900 chr7D 88.901 955 102 4 428 1381 12188794 12187843 0.000000e+00 1173.0
13 TraesCS7A01G028900 chr7D 80.783 1150 191 18 442 1563 12125887 12127034 0.000000e+00 872.0
14 TraesCS7A01G028900 chr7D 80.696 1150 191 19 442 1563 49233418 49232272 0.000000e+00 865.0
15 TraesCS7A01G028900 chr4A 88.265 980 110 5 440 1417 725859902 725860878 0.000000e+00 1168.0
16 TraesCS7A01G028900 chr2D 84.028 144 20 3 1765 1906 523385830 523385972 4.010000e-28 135.0
17 TraesCS7A01G028900 chr4D 81.646 158 26 3 1766 1921 45417931 45418087 6.700000e-26 128.0
18 TraesCS7A01G028900 chr2B 88.333 60 6 1 1811 1870 3420627 3420569 1.150000e-08 71.3


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS7A01G028900 chr7A 11844045 11846356 2311 False 1858 3496 100.00000 1 2312 2 chr7A.!!$F2 2311
1 TraesCS7A01G028900 chr7A 11891004 11892299 1295 False 2364 2364 99.61400 1018 2312 1 chr7A.!!$F1 1294
2 TraesCS7A01G028900 chr7A 11943896 11945951 2055 False 1751 3282 98.97200 1 2312 2 chr7A.!!$F3 2311
3 TraesCS7A01G028900 chr7A 11581412 11582399 987 True 1206 1206 88.69800 428 1417 1 chr7A.!!$R1 989
4 TraesCS7A01G028900 chr7B 717051354 717052470 1116 True 1696 1696 94.09700 873 1987 1 chr7B.!!$R2 1114
5 TraesCS7A01G028900 chr7B 717026020 717029283 3263 True 717 2013 93.55125 1 2312 4 chr7B.!!$R3 2311
6 TraesCS7A01G028900 chr7D 12187843 12188794 951 True 1173 1173 88.90100 428 1381 1 chr7D.!!$R1 953
7 TraesCS7A01G028900 chr7D 12125887 12127034 1147 False 872 872 80.78300 442 1563 1 chr7D.!!$F1 1121
8 TraesCS7A01G028900 chr7D 49232272 49233418 1146 True 865 865 80.69600 442 1563 1 chr7D.!!$R2 1121
9 TraesCS7A01G028900 chr4A 725859902 725860878 976 False 1168 1168 88.26500 440 1417 1 chr4A.!!$F1 977

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
863 872 1.794701 CAACGCATATGTGGATCCTCG 59.205 52.381 19.94 7.3 0.0 4.63 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2060 2252 0.622738 ATCAGAGGGATGTGGGCTGT 60.623 55.0 0.0 0.0 34.06 4.4 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
476 479 5.009010 GGAGATCAAAACTGAGCACTCAAAA 59.991 40.000 1.42 0.0 39.39 2.44
863 872 1.794701 CAACGCATATGTGGATCCTCG 59.205 52.381 19.94 7.3 0.00 4.63
1633 1676 5.902681 TGTGTTGAACTTATCTATCTCCCG 58.097 41.667 0.00 0.0 0.00 5.14
2060 2252 4.627801 TGTGCAAACCGGCGCCTA 62.628 61.111 26.68 0.0 43.47 3.93
2111 2305 4.196193 CCGGTCCATGTATCTGCTTTTAA 58.804 43.478 0.00 0.0 0.00 1.52
2113 2307 5.299279 CCGGTCCATGTATCTGCTTTTAATT 59.701 40.000 0.00 0.0 0.00 1.40
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
506 510 2.224719 GGAGCTTGGTCATGGATATGCT 60.225 50.000 0.00 0.0 34.21 3.79
863 872 4.929808 TCGTTAAACAGAATTCCTCTCTGC 59.070 41.667 0.65 0.0 43.48 4.26
1480 1522 9.449719 TTGTAAGACTTTGAAGAAAGAAAGACT 57.550 29.630 0.00 0.0 41.12 3.24
2060 2252 0.622738 ATCAGAGGGATGTGGGCTGT 60.623 55.000 0.00 0.0 34.06 4.40


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.